» Site Navigation
0 members and 774 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Re: the only dumb question.....
 Originally Posted by GenePirate
This is an excellent question. Glad you asked. I don't think the answer is as easy as it seems.
Sorry, Rebel, didn't mean to kill your Friday. This is a topic that I started working on with Greg Graziani a year or so ago, but I dropped the ball because I got overwhelmed in trying to find contract electron microscopy laboratories that didn't charge a "caramel glow" for a couple of pics. Actually, its not THAT expensive, but still beyond my budget right now.
You should have posted here if you were looking for some SEM imaging. I have access to one, for free.
-
-
BPnet Veteran
Re: the only dumb question.....
 Originally Posted by Spaniard
Wow I need to break out my VPI book and re-read that Skin and Color section...my head-o-phores are going to explode!
Head-o-phores--that's classic! LOL I won't soon forget that one!
-
-
Re: the only dumb question.....
i need to pick up this VPI book. does it cover pigmentation and how its expressed in the different morphs?
-
-
Re: the only dumb question.....
My book is in my desk at work, so when I get in on monday I will look through it and see. Nothing in detail, that much I can remember. Its a beautiful book though lots of great pictures and good information. Well worth the $75 bucks IMO.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Re: the only dumb question.....
 Originally Posted by tonkatoyman
That was clear as mud but it does cover the ground  However I'm so glad there are people out there researching our industry. This can only be good for all of us. By the way you already bent my brain 
Sorry I bent your brain and was clear as mud, I do tend to lapse into jargon when I am talking with someone who is in my field.
I can work to keep it at a more layman level if you like.
 Originally Posted by kc261
I can't quite follow all of what gene pirate and asplundii are talking about, but I will say it sure is refreshing to see a thread that goes a lot deeper than "if I pair my het pied with my pastel, will I get pastel pieds?"
Thanks guys!
Always glad to hear that people appreciate the deep stuff even if it is a little jargon filled. Thanks 
 Originally Posted by GenePirate
Knew I could count on you. I'll think more about what you said this weekend, too, and get back with you.
Well, I thought on it and I did not come up with a lot more. Considering all the types of albino (T- and all the different T+) I am leaning more toward my speculation that there is some character of the BP melanin itself that lends to the overall reddish tint on the animals. I do not know how best to articulate my reasoning but the lack of any red cast in the T- albino but the obvious purple/red hue to the various T+ albinos just makes me lean toward that being the most likely explanation.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: the only dumb question.....
 Originally Posted by Lucas339
i need to pick up this VPI book. does it cover pigmentation and how its expressed in the different morphs?
Hey Lucas,
I checked my book and they do not go over how the pigmentation is expressed in morphs. They do you a couple pages worth of information on melanophores, xanthophores, and iridophores.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|