Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 580

1 members and 579 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 4 of 5 FirstFirst 12345 LastLast
Results 31 to 40 of 45
  1. #31
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by PythonWallace View Post
    We'll just agree to agree, then.
    I can live with that
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #32
    Registered User
    Join Date
    05-31-2009
    Location
    Ontario, Canada.
    Posts
    82
    Thanks
    26
    Thanked 9 Times in 8 Posts

    Re: The Blue-Eyed Leucistic Ball Python

    ok so if you breed a BEL produced by a mojave x mojave to a normal, will you get all mojaves?

    And if you breed one made by lesser x lesser, all lessers?

    What about a lesser x mojave to a normal?

  3. #33
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by Drewp View Post
    ok so if you breed a BEL produced by a mojave x mojave to a normal, will you get all mojaves?
    Yes

    And if you breed one made by lesser x lesser, all lessers?
    Yes

    What about a lesser x mojave to a normal?
    50% of the clutch should be lesser and the other 50% should be mojo. Unless the odds gods are in a mood.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #34
    Registered User FragginDragon's Avatar
    Join Date
    02-24-2009
    Location
    Eastern Michigan
    Posts
    172
    Thanks
    123
    Thanked 52 Times in 40 Posts
    Images: 1

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by FragginDragon View Post
    OK, so what if you bred two BEL's that were products of a mojave x lesser? Or a mojave x mojave?
    Quote Originally Posted by asplundii View Post
    The prior would have the potential for lesser x lesser, lesser x mojo and mojo x mojo.

    The latter would only give mojo x mojo offspring
    I'm sorry, but I don't understand your answer, maybe I'm missing something.
    Are you saying that in the former mating I would get mojave's, lesser's, and BEL's?
    And in the latter pairing, I would get mojave's and BEL's?
    The Cake is a Lie
    John Cordone
    Blue Water Reptiles
    I'm a BOI Good Guy!

  5. #35
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by FragginDragon View Post
    I'm sorry, but I don't understand your answer, maybe I'm missing something.
    Are you saying that in the former mating I would get mojave's, lesser's, and BEL's?
    And in the latter pairing, I would get mojave's and BEL's?
    ok lets start from the top

    if you bred two BEL's all your offspring are going to be BEL no matter what the 2 orginal BEL were. its impossible to get a lesser or mojo or anything.

    now how clean those BEL would be would depend on the genes they get, if they got lesser x lesser gene they would be pretty clean, if they got mojo x mojo genes they would most likly have the dirty head, mojo x lesser ive seen go both ways.

    now you asked what would happen if you bred two BEL that were lesser x mojos?
    25% lesser x lesser
    50% mojo x lesser
    25% mojo x mojo

    now could you 100% tell the difference between all of them... probally not. is it a lower lesserxlesser or a mojoxlesser, is it a lower lesserxmojo or a mojoxmojo... i donno how you could tell.

    and two mojo x mojo BEL would jsut make all mojo x mojo offspring.

  6. The Following User Says Thank You to OhhWatALoser For This Useful Post:

    FragginDragon (06-04-2009)

  7. #36
    Registered User
    Join Date
    12-28-2007
    Location
    Phoenix, AZ
    Posts
    155
    Thanks
    21
    Thanked 115 Times in 62 Posts
    Images: 1

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by OhhWatALoser View Post
    now how clean those BEL would be would depend on the genes they get, if they got lesser x lesser gene they would be pretty clean, if they got mojo x mojo genes they would most likly have the dirty head, mojo x lesser ive seen go both ways.

    now you asked what would happen if you bred two BEL that were lesser x mojos?
    25% lesser x lesser
    50% mojo x lesser
    25% mojo x mojo

    now could you 100% tell the difference between all of them... probally not. is it a lower lesserxlesser or a mojoxlesser, is it a lower lesserxmojo or a mojoxmojo... i donno how you could tell.
    Mojave x lesser leucistics are very white. There's no way you could mistake one for a super mojave, or vice versa. I think you would have a hard time telling the lesser x lesser leucistics from the mojave x lesser leucistics though.

  8. #37
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28

    Re: The Blue-Eyed Leucistic Ball Python

    It will be interesting to see how this complex is marketed as they become more common and more crosses are done and it gets harder and harder to sort things out. Say you bred a lesser\\phantom X butter\\Vin Russo. We don't know for sure yet but I bet all four possible combos of the babies (lesser\\butter, lesser\\Vin Russo, phantom\\butter, phantom\\Vin Russo) would be white and look a lot alike (maybe not the best example if lesser and butter are the same). Already I see ads for just "leucistic" and I guess you are left to ask about the parentage. Would make some difference though as I'd love to have a shot at one with phantom even if it would take the right pairing to find out. If you could identify a pair with phantom in it those white snakes could produce the 25% homozygous phantom that isn't white in the next generation.

  9. #38
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by jluman View Post
    Mojave x lesser leucistics are very white. There's no way you could mistake one for a super mojave, or vice versa. I think you would have a hard time telling the lesser x lesser leucistics from the mojave x lesser leucistics though.
    i've seen some mojo x lessers that were pretty dirty looking, i thought they were super mojos but he swore to me they were lesser x mojo. mayb i got lied to tho.

  10. #39
    BPnet Veteran SGExotics's Avatar
    Join Date
    12-08-2008
    Posts
    938
    Thanks
    290
    Thanked 113 Times in 95 Posts
    Images: 2

    Re: The Blue-Eyed Leucistic Ball Python

    Im not sure about anyone else, but i like the super phantom and the mystic potion A LOT more than the BEl! But the BEL is still awesome!

  11. #40
    BPnet Lifer muddoc's Avatar
    Join Date
    03-23-2006
    Location
    Louisiana
    Posts
    5,340
    Thanks
    1,202
    Thanked 1,606 Times in 618 Posts
    Images: 49

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by OhhWatALoser View Post
    I was told a lesser x lesser breeding will produce the most stunning BEL you can get, but thats always going to be a debate.
    Just a bit of simple symantics, but I think the word stunning is an opinion. I myself believe that the Super Mojave is more stunning than the Super Lesser. However, I will agree that the Super Lesser is the cleanest BEL.

    Quote Originally Posted by PythonWallace View Post
    You can say whatever you want, but a mojo x mojo makes leucistics. You can call them skidmarks if you want, but that doesn't change the fact that they are lucies.

    Phantom x phantom and phantom x mojave do not make lucies. You can call them "dirty lucies" if you want, but by definition, if it has a pattern and xanthiphore and melanin, it cannot be a lucy. A patternless white snake, whether it has a "dirty" head or not, is leucistic.
    Jake,
    Just my opinion on the matter, but I thought I would interject my understanding of Leucism. If I understand the condition correctly, it is actually caused by a lack of, or turned off chromatophores. Chromatophores are the cells in the skin that are responsible for displaying pigment. If they are absent or turned off, then the skin does not hold pigment. That would mean that the pigments are present in the animal, but the skin does not hold them. Therefore, a Leucy would actually have xanthriphores, melanin, and any other pigments that may be acting in Ball Pythons.

    Just my .02,
    Last edited by muddoc; 06-04-2009 at 10:12 AM. Reason: formatting
    Tim Bailey
    (A.K.A. MBM or Art Pimp)
    www.baileyreptiles.com
    The Blog

Page 4 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1