» Site Navigation
1 members and 579 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by PythonWallace
We'll just agree to agree, then. 
I can live with that
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: The Blue-Eyed Leucistic Ball Python
ok so if you breed a BEL produced by a mojave x mojave to a normal, will you get all mojaves?
And if you breed one made by lesser x lesser, all lessers?
What about a lesser x mojave to a normal?
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by Drewp
ok so if you breed a BEL produced by a mojave x mojave to a normal, will you get all mojaves?
Yes
And if you breed one made by lesser x lesser, all lessers?
Yes
What about a lesser x mojave to a normal?
50% of the clutch should be lesser and the other 50% should be mojo. Unless the odds gods are in a mood.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by FragginDragon
OK, so what if you bred two BEL's that were products of a mojave x lesser? Or a mojave x mojave?
 Originally Posted by asplundii
The prior would have the potential for lesser x lesser, lesser x mojo and mojo x mojo.
The latter would only give mojo x mojo offspring
I'm sorry, but I don't understand your answer, maybe I'm missing something.
Are you saying that in the former mating I would get mojave's, lesser's, and BEL's?
And in the latter pairing, I would get mojave's and BEL's?
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by FragginDragon
I'm sorry, but I don't understand your answer, maybe I'm missing something.
Are you saying that in the former mating I would get mojave's, lesser's, and BEL's?
And in the latter pairing, I would get mojave's and BEL's?
ok lets start from the top
if you bred two BEL's all your offspring are going to be BEL no matter what the 2 orginal BEL were. its impossible to get a lesser or mojo or anything.
now how clean those BEL would be would depend on the genes they get, if they got lesser x lesser gene they would be pretty clean, if they got mojo x mojo genes they would most likly have the dirty head, mojo x lesser ive seen go both ways.
now you asked what would happen if you bred two BEL that were lesser x mojos?
25% lesser x lesser
50% mojo x lesser
25% mojo x mojo
now could you 100% tell the difference between all of them... probally not. is it a lower lesserxlesser or a mojoxlesser, is it a lower lesserxmojo or a mojoxmojo... i donno how you could tell.
and two mojo x mojo BEL would jsut make all mojo x mojo offspring.
-
The Following User Says Thank You to OhhWatALoser For This Useful Post:
FragginDragon (06-04-2009)
-
Registered User
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by OhhWatALoser
now how clean those BEL would be would depend on the genes they get, if they got lesser x lesser gene they would be pretty clean, if they got mojo x mojo genes they would most likly have the dirty head, mojo x lesser ive seen go both ways.
now you asked what would happen if you bred two BEL that were lesser x mojos?
25% lesser x lesser
50% mojo x lesser
25% mojo x mojo
now could you 100% tell the difference between all of them... probally not. is it a lower lesserxlesser or a mojoxlesser, is it a lower lesserxmojo or a mojoxmojo... i donno how you could tell.
Mojave x lesser leucistics are very white. There's no way you could mistake one for a super mojave, or vice versa. I think you would have a hard time telling the lesser x lesser leucistics from the mojave x lesser leucistics though.
-
-
Re: The Blue-Eyed Leucistic Ball Python
It will be interesting to see how this complex is marketed as they become more common and more crosses are done and it gets harder and harder to sort things out. Say you bred a lesser\\phantom X butter\\Vin Russo. We don't know for sure yet but I bet all four possible combos of the babies (lesser\\butter, lesser\\Vin Russo, phantom\\butter, phantom\\Vin Russo) would be white and look a lot alike (maybe not the best example if lesser and butter are the same). Already I see ads for just "leucistic" and I guess you are left to ask about the parentage. Would make some difference though as I'd love to have a shot at one with phantom even if it would take the right pairing to find out. If you could identify a pair with phantom in it those white snakes could produce the 25% homozygous phantom that isn't white in the next generation.
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by jluman
Mojave x lesser leucistics are very white. There's no way you could mistake one for a super mojave, or vice versa. I think you would have a hard time telling the lesser x lesser leucistics from the mojave x lesser leucistics though.
i've seen some mojo x lessers that were pretty dirty looking, i thought they were super mojos but he swore to me they were lesser x mojo. mayb i got lied to tho.
-
-
BPnet Veteran
Re: The Blue-Eyed Leucistic Ball Python
Im not sure about anyone else, but i like the super phantom and the mystic potion A LOT more than the BEl! But the BEL is still awesome!
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by OhhWatALoser
I was told a lesser x lesser breeding will produce the most stunning BEL you can get, but thats always going to be a debate.
Just a bit of simple symantics, but I think the word stunning is an opinion. I myself believe that the Super Mojave is more stunning than the Super Lesser. However, I will agree that the Super Lesser is the cleanest BEL.
 Originally Posted by PythonWallace
You can say whatever you want, but a mojo x mojo makes leucistics. You can call them skidmarks if you want, but that doesn't change the fact that they are lucies.
Phantom x phantom and phantom x mojave do not make lucies. You can call them "dirty lucies" if you want, but by definition, if it has a pattern and xanthiphore and melanin, it cannot be a lucy. A patternless white snake, whether it has a "dirty" head or not, is leucistic.
Jake,
Just my opinion on the matter, but I thought I would interject my understanding of Leucism. If I understand the condition correctly, it is actually caused by a lack of, or turned off chromatophores. Chromatophores are the cells in the skin that are responsible for displaying pigment. If they are absent or turned off, then the skin does not hold pigment. That would mean that the pigments are present in the animal, but the skin does not hold them. Therefore, a Leucy would actually have xanthriphores, melanin, and any other pigments that may be acting in Ball Pythons.
Just my .02,
Last edited by muddoc; 06-04-2009 at 10:12 AM.
Reason: formatting
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|