» Site Navigation
3 members and 660 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Re: The Blue-Eyed Leucistic Ball Python
i asked ralph davis for permission to use his pic, he hasn't got back to me, but i also asked him what phantom combos do and do not make BEL's, can anyone answer that? i was told they all made BELs
Phantom x Mojave = ?
Phantom x Lesser = ?
Phantom x Butter = ?
Phantom x Russo Het = ?
-
-
Re: The Blue-Eyed Leucistic Ball Python
The only one I remember reading about being done was Lesser X Phantom. That produced Karma, one of the first captive hatched white snakes. Ralph has butters so maybe he did that one too but I'm not at all sure the Mojave or Het Russo cross has been done yet with the original Phantom.
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by PythonWallace
mystic x mojave does not make a BEL.
I am not sure I would say that. The snake produced by a mystic x mojo or a phantom x phantom is a blue eyed snake with a bit of pattern showing through... We do not say that mojo x mojo are not BluELs just cause they have a purple head, we just say they are "dirty". So by the same token, the mystic x mojo and the super phantom (and one presumes the super mystic and the phantom x mojo) are just "really really dirty" BluELs.
At least that is how I look at it.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by asplundii
I am not sure I would say that. The snake produced by a mystic x mojo or a phantom x phantom is a blue eyed snake with a bit of pattern showing through... We do not say that mojo x mojo are not BluELs just cause they have a purple head, we just say they are "dirty". So by the same token, the mystic x mojo and the super phantom (and one presumes the super mystic and the phantom x mojo) are just "really really dirty" BluELs.
At least that is how I look at it.
You can say whatever you want, but a mojo x mojo makes leucistics. You can call them skidmarks if you want, but that doesn't change the fact that they are lucies.
Phantom x phantom and phantom x mojave do not make lucies. You can call them "dirty lucies" if you want, but by definition, if it has a pattern and xanthiphore and melanin, it cannot be a lucy. A patternless white snake, whether it has a "dirty" head or not, is leucistic.
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by PythonWallace
but by definition, if it has a pattern and xanthiphore and melanin, it cannot be a lucy. A patternless white snake, whether it has a "dirty" head or not, is leucistic.
And yet the dirty head of a super mojo is the result of the presence of melanin, so your argument falls apart... And even the cleanest BluELs can have a faint pattern to them. So, by your definition, neither of those are BluELs
And, somewhat tangential, the super fire/sulfur has yellow blotching and yet we still call them luecies...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by asplundii
And yet the dirty head of a super mojo is the result of the presence of melanin, so your argument falls apart... And even the cleanest BluELs can have a faint pattern to them. So, by your definition, neither of those are BluELs
And, somewhat tangential, the super fire/sulfur has yellow blotching and yet we still call them luecies...
They aren't my definitions. But I was talking about animals having a common visible pattern that contains varying degrees of those color pigments. A faded snake isn't a lucy. I understand what you are saying, but the definitions are already established, so you would be rogue to start calling the mystic potion or super phantom BELs, or a super mojave anything other than a lucy. Again, I understand your logic, but the definitions are already established and accepted. And as far as the super fire, I agree that it's odd that they are still called lucies with the yellow blotching, but I didn't prove the gene, so I don't get to name it.
-
-
Registered User
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by MarkS
Well, in theory, if you bred two Blue eyed Leucistics together that were them selves the result of a lesser X phantom cross, (ie: Karmas) You could produce about 25% Super phantoms.
OK, so what if you bred two BEL's that were products of a mojave x lesser? Or a mojave x mojave?
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by PythonWallace
I understand what you are saying, but the definitions are already established, so you would be rogue to start calling the mystic potion or super phantom BELs, or a super mojave anything other than a lucy.
Well I did say:
 Originally Posted by asplundii
At least that is how I look at it.

I get that the "established definitions" are there but sometimes they are just not quite right. I hate and will continue to hate the usage of the term "co-dom" to explain morphs because it is totally and completely in error. And I know I can not change that usage either but that does not make it correct....
As for me being a rogue... would not be the first time, likely won't be the last either. But life is more fun being the nutjob
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by FragginDragon
OK, so what if you bred two BEL's that were products of a mojave x lesser? Or a mojave x mojave?
The prior would have the potential for lesser x lesser, lesser x mojo and mojo x mojo.
The latter would only give mojo x mojo offspring
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: The Blue-Eyed Leucistic Ball Python
 Originally Posted by asplundii
Well I did say:
I get that the "established definitions" are there but sometimes they are just not quite right. I hate and will continue to hate the usage of the term "co-dom" to explain morphs because it is totally and completely in error. And I know I can not change that usage either but that does not make it correct....
As for me being a rogue... would not be the first time, likely won't be the last either. But life is more fun being the nutjob 
We'll just agree to agree, then.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|