Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 677

0 members and 677 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 3 of 5 FirstFirst 12345 LastLast
Results 21 to 30 of 45
  1. #21
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: The Blue-Eyed Leucistic Ball Python

    i asked ralph davis for permission to use his pic, he hasn't got back to me, but i also asked him what phantom combos do and do not make BEL's, can anyone answer that? i was told they all made BELs

    Phantom x Mojave = ?
    Phantom x Lesser = ?
    Phantom x Butter = ?
    Phantom x Russo Het = ?

  2. #22
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28

    Re: The Blue-Eyed Leucistic Ball Python

    The only one I remember reading about being done was Lesser X Phantom. That produced Karma, one of the first captive hatched white snakes. Ralph has butters so maybe he did that one too but I'm not at all sure the Mojave or Het Russo cross has been done yet with the original Phantom.

  3. #23
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by PythonWallace View Post
    mystic x mojave does not make a BEL.
    I am not sure I would say that. The snake produced by a mystic x mojo or a phantom x phantom is a blue eyed snake with a bit of pattern showing through... We do not say that mojo x mojo are not BluELs just cause they have a purple head, we just say they are "dirty". So by the same token, the mystic x mojo and the super phantom (and one presumes the super mystic and the phantom x mojo) are just "really really dirty" BluELs.

    At least that is how I look at it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #24
    BPnet Veteran PythonWallace's Avatar
    Join Date
    02-26-2007
    Location
    Woodridge, IL
    Posts
    2,967
    Thanks
    204
    Thanked 346 Times in 210 Posts
    Images: 23

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by asplundii View Post
    I am not sure I would say that. The snake produced by a mystic x mojo or a phantom x phantom is a blue eyed snake with a bit of pattern showing through... We do not say that mojo x mojo are not BluELs just cause they have a purple head, we just say they are "dirty". So by the same token, the mystic x mojo and the super phantom (and one presumes the super mystic and the phantom x mojo) are just "really really dirty" BluELs.

    At least that is how I look at it.
    You can say whatever you want, but a mojo x mojo makes leucistics. You can call them skidmarks if you want, but that doesn't change the fact that they are lucies.

    Phantom x phantom and phantom x mojave do not make lucies. You can call them "dirty lucies" if you want, but by definition, if it has a pattern and xanthiphore and melanin, it cannot be a lucy. A patternless white snake, whether it has a "dirty" head or not, is leucistic.
    What are these mojavas I keep hearing so much about?

    J. W. Exotics

    Reptile Incubators

  5. #25
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by PythonWallace View Post
    but by definition, if it has a pattern and xanthiphore and melanin, it cannot be a lucy. A patternless white snake, whether it has a "dirty" head or not, is leucistic.
    And yet the dirty head of a super mojo is the result of the presence of melanin, so your argument falls apart... And even the cleanest BluELs can have a faint pattern to them. So, by your definition, neither of those are BluELs

    And, somewhat tangential, the super fire/sulfur has yellow blotching and yet we still call them luecies...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #26
    BPnet Veteran PythonWallace's Avatar
    Join Date
    02-26-2007
    Location
    Woodridge, IL
    Posts
    2,967
    Thanks
    204
    Thanked 346 Times in 210 Posts
    Images: 23

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by asplundii View Post
    And yet the dirty head of a super mojo is the result of the presence of melanin, so your argument falls apart... And even the cleanest BluELs can have a faint pattern to them. So, by your definition, neither of those are BluELs

    And, somewhat tangential, the super fire/sulfur has yellow blotching and yet we still call them luecies...
    They aren't my definitions. But I was talking about animals having a common visible pattern that contains varying degrees of those color pigments. A faded snake isn't a lucy. I understand what you are saying, but the definitions are already established, so you would be rogue to start calling the mystic potion or super phantom BELs, or a super mojave anything other than a lucy. Again, I understand your logic, but the definitions are already established and accepted. And as far as the super fire, I agree that it's odd that they are still called lucies with the yellow blotching, but I didn't prove the gene, so I don't get to name it.
    What are these mojavas I keep hearing so much about?

    J. W. Exotics

    Reptile Incubators

  7. #27
    Registered User FragginDragon's Avatar
    Join Date
    02-24-2009
    Location
    Eastern Michigan
    Posts
    172
    Thanks
    123
    Thanked 52 Times in 40 Posts
    Images: 1

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by MarkS View Post
    Well, in theory, if you bred two Blue eyed Leucistics together that were them selves the result of a lesser X phantom cross, (ie: Karmas) You could produce about 25% Super phantoms.
    OK, so what if you bred two BEL's that were products of a mojave x lesser? Or a mojave x mojave?
    The Cake is a Lie
    John Cordone
    Blue Water Reptiles
    I'm a BOI Good Guy!

  8. #28
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by PythonWallace View Post
    I understand what you are saying, but the definitions are already established, so you would be rogue to start calling the mystic potion or super phantom BELs, or a super mojave anything other than a lucy.
    Well I did say:

    Quote Originally Posted by asplundii View Post
    At least that is how I look at it.


    I get that the "established definitions" are there but sometimes they are just not quite right. I hate and will continue to hate the usage of the term "co-dom" to explain morphs because it is totally and completely in error. And I know I can not change that usage either but that does not make it correct....

    As for me being a rogue... would not be the first time, likely won't be the last either. But life is more fun being the nutjob
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #29
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by FragginDragon View Post
    OK, so what if you bred two BEL's that were products of a mojave x lesser? Or a mojave x mojave?
    The prior would have the potential for lesser x lesser, lesser x mojo and mojo x mojo.

    The latter would only give mojo x mojo offspring
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #30
    BPnet Veteran PythonWallace's Avatar
    Join Date
    02-26-2007
    Location
    Woodridge, IL
    Posts
    2,967
    Thanks
    204
    Thanked 346 Times in 210 Posts
    Images: 23

    Re: The Blue-Eyed Leucistic Ball Python

    Quote Originally Posted by asplundii View Post
    Well I did say:



    I get that the "established definitions" are there but sometimes they are just not quite right. I hate and will continue to hate the usage of the term "co-dom" to explain morphs because it is totally and completely in error. And I know I can not change that usage either but that does not make it correct....

    As for me being a rogue... would not be the first time, likely won't be the last either. But life is more fun being the nutjob
    We'll just agree to agree, then.
    What are these mojavas I keep hearing so much about?

    J. W. Exotics

    Reptile Incubators

Page 3 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1