» Site Navigation
3 members and 2,290 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,069
Threads: 249,218
Posts: 2,572,786
Top Poster: JLC (31,651)
|
-
Re: Swine Flu
 Originally Posted by Egapal
You fail to mention one thing because it doesn't help your point at all.
The definition of a good host for a disease is one that lives long enough to spread the disease. Diseases can dead end because they are far too deadly to continue on in the new species. Normally this is not a problem but modern travel allows disease to spread world wide where in the past a single civilation would have been destroyed.
No, actually I did not fail to mention the jumbo jet vector because it is moot to my point. And I contend your definition of "good host", you need to do more than just spread the disease. You need to sustainably spread the disease. If you, as a host, die too fast then the outbreak burns out because it can not spread. I readily admit that it is possible to spread diseases via global travel but it does not change the fact that a dead end host is a dead end host. There is a reason we do not see Ebola making it into LA or DC or NY. It burns up the available host too fast to spread. Dead. End.
There are real concerns for people here, just not with this strain of flu.
But it is only things like this strain of flu that are the prime candidates for the jumbo jet vectors to rapidly spread them world wide. Because they are not such horrid, debilitating agents. They make you sick but not enough to stop you from going anywhere. They are highly transmissible but they keep you on your feet spreading the disease around.
And, as I said above, this flu is not even in the same class as the things that vid clip was describing. This flu was human in origin, NOT animal. Until recently it has only been spread human to human and the data on the infected pigs in Canada is not all in yet so we way be jumping the gun to say it has jumped species (and then we may not, I am waiting for the hard data.)
There are examples in modern history of species being eliminated from disease even when the best and brightest minds tried to prevent it. The bananas we eat today are not the bananas our grandparents ate. Their bananas are all dead. We only have wine today because the roots of new world grapes are resistant to the disease we spread that nearly wiped out old world grapes.
Apples to oranges. Agricultural species, being predominantly homogeneous, have little genetic diversity putting them at a reduced fitness on the population scale.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|