» Site Navigation
0 members and 2,013 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,107
Threads: 249,255
Posts: 2,572,991
Top Poster: JLC (31,651)
|
-
Re: Swine Flu
Warning nws!
 Originally Posted by serpents_den
to many of you speculate without doing any research. If your only source for information is assuming or from corporate government owned media than you can see why this country has gone to hell.
George carlin rip
**video removed as inappropriate**
Last edited by dr del; 05-06-2009 at 04:39 PM.
Reason: matching quote to moderated post
-
-
Re: Swine Flu
 Originally Posted by asplundii
Diseases tend to be very host specific and when they make the jump 99.999% of the time it is a dead end jump because the new host is not a fit environment for the disease.
You fail to mention one thing because it doesn't help your point at all.
The definition of a good host for a disease is one that lives long enough to spread the disease. Diseases can dead end because they are far too deadly to continue on in the new species. Normally this is not a problem but modern travel allows disease to spread world wide where in the past a single civilation would have been destroyed. There are real concerns for people here, just not with this strain of flu. There are examples in modern history of species being eliminated from disease even when the best and brightest minds tried to prevent it. The bananas we eat today are not the bananas our grandparents ate. Their bananas are all dead. We only have wine today because the roots of new world grapes are resistant to the disease we spread that nearly wiped out old world grapes.
-
-
Re: Swine Flu
 Originally Posted by Egapal
You fail to mention one thing because it doesn't help your point at all.
The definition of a good host for a disease is one that lives long enough to spread the disease. Diseases can dead end because they are far too deadly to continue on in the new species. Normally this is not a problem but modern travel allows disease to spread world wide where in the past a single civilation would have been destroyed.
No, actually I did not fail to mention the jumbo jet vector because it is moot to my point. And I contend your definition of "good host", you need to do more than just spread the disease. You need to sustainably spread the disease. If you, as a host, die too fast then the outbreak burns out because it can not spread. I readily admit that it is possible to spread diseases via global travel but it does not change the fact that a dead end host is a dead end host. There is a reason we do not see Ebola making it into LA or DC or NY. It burns up the available host too fast to spread. Dead. End.
There are real concerns for people here, just not with this strain of flu.
But it is only things like this strain of flu that are the prime candidates for the jumbo jet vectors to rapidly spread them world wide. Because they are not such horrid, debilitating agents. They make you sick but not enough to stop you from going anywhere. They are highly transmissible but they keep you on your feet spreading the disease around.
And, as I said above, this flu is not even in the same class as the things that vid clip was describing. This flu was human in origin, NOT animal. Until recently it has only been spread human to human and the data on the infected pigs in Canada is not all in yet so we way be jumping the gun to say it has jumped species (and then we may not, I am waiting for the hard data.)
There are examples in modern history of species being eliminated from disease even when the best and brightest minds tried to prevent it. The bananas we eat today are not the bananas our grandparents ate. Their bananas are all dead. We only have wine today because the roots of new world grapes are resistant to the disease we spread that nearly wiped out old world grapes.
Apples to oranges. Agricultural species, being predominantly homogeneous, have little genetic diversity putting them at a reduced fitness on the population scale.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Swine Flu
Why is this new H1N1 virus sometimes called “swine flu”?
This virus was originally referred to as “swine flu” because laboratory testing showed that many of the genes in this new virus were very similar to influenza viruses that normally occur in pigs in North America. But further study has shown that this new virus is very different from what normally circulates in North American pigs. It has two genes from flu viruses that normally circulate in pigs in Europe and Asia and avian genes and human genes. Scientists call this a “quadruple reassortant” virus.
Where did this virus get these genes?? from just people right ? no these genes are from a pig,human and avian which is from CLOSE contact with affected animals. Just as the video tells you animals gave humans the virus because of the way the animal/meat was taken care of. Heavy world travel spreds the virus thoughout the world and can't die out like they used to many years ago which can create a "super virus" like aids.
Too many pets to list!
-
-
Re: Swine Flu
 Originally Posted by rebeccabecca
Why is this new H1N1 virus sometimes called “swine flu”?
This "new" flu was originally called "Swine flu" because of traditional flu nomenclature. It has nothing, zip, zilch, nada to do with where the strain came from. Which is why the authorities on this kind of stuff (CDC, WHO, etc) pushed to drop the "Swine" epithet because it was leading to unnecessary confusion and unsound decisions (like killing every pig in some countries.) The genetic evidence has show that this flu is 100% human in origin. Again, if you did the basic background research into this outbreak and flu in general you would know that
This virus was originally referred to as “swine flu” because laboratory testing showed that many of the genes in this new virus were very similar to influenza viruses that normally occur in pigs in North America.
Not quite no. This strain was originally referred to as "swine flu" because it is of a type (H1N1) that are predominantly found circulating in pig populations. However, these strains also readily circulate in human populations and H1N1 strains have been circulating in the human population since at least 1917 if not before. H1N1 strains have also been part of the make up of most flu vaccines for the last 10 years or so.
But further study has shown that this new virus is very different from what normally circulates in North American pigs. It has two genes from flu viruses that normally circulate in pigs in Europe and Asia and avian genes and human genes.
It is no more "very different" than any other time there has been a shift.
Scientists call this a “quadruple reassortant” virus.
No actually call it a triple reassortment because it is composed of: 1) swine 2) avian and 3) human components.
Where did this virus get these genes?? from just people right ? no these genes are from a pig,human and avian which is from CLOSE contact with affected animals.
I am sorry this is just flat out not the case. Every gene in this novel strain of the flu is of human origin. The research shows that. This strain came about through a perfectly normal process of flu evolution called a shift. You might try looking that up.
Just as the video tells you animals gave humans the virus because of the way the animal/meat was taken care of.
There is a terminal flaw in that argument. First off that video is not even discussing flu at all let alone this specific flu strain. Secondly, I have said it twice now and I will say it again; what is being discussed in that video has no bearing on this current flu. We are not introducing some totally new and unknown agent from an epizootic source.
Heavy world travel spreads the virus thoughout the world and can't die out like they used to many years ago which can create a "super virus" like aids.
Obviously you ignored what I said above. Yes, heavy (or more appropriately rapid) world travel can and does spread diseases. But those best suited to the jumbo jet vector are the ones that are not debilitating because they allow/encourage the infected to travel in spite of the fact that they are sick. If you are too sick to move then you sure as heck are not going to get on a plane so any disease that makes you "too sick" is much less likely to spread and much more likely to just burn out in one small area. Like happens whenever there is an Ebola outbreak.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Swine Flu
Below is a link to the CDC website that explains the H1N1 (swine) flu:
http://www.cdc.gov/h1n1flu/qa.htm
Eddie Strong, Jr. 
-
-
Re: Swine Flu
 Originally Posted by asplundii
No, actually I did not fail to mention the jumbo jet vector because it is moot to my point. And I contend your definition of "good host", you need to do more than just spread the disease. You need to sustainably spread the disease. If you, as a host, die too fast then the outbreak burns out because it can not spread. I readily admit that it is possible to spread diseases via global travel but it does not change the fact that a dead end host is a dead end host. There is a reason we do not see Ebola making it into LA or DC or NY. It burns up the available host too fast to spread. Dead. End. But it is only things like this strain of flu that are the prime candidates for the jumbo jet vectors to rapidly spread them world wide. Because they are not such horrid, debilitating agents. They make you sick but not enough to stop you from going anywhere. They are highly transmissible but they keep you on your feet spreading the disease around.
You really have a way of not taking into account the mutable nature of a virus strain. I accept your definition of a good host. Diseases that we are good hosts for are not a big deal. We live with them, literally. Diseases we are a bad host for are of great concern. Comparing Ebola to the Flu is like comparing apples to oranges. The Flu is much easier to spread and takes much longer to kill in the rare cases that it does kill. The key point I am trying to make is that strains mutate. I more deadly form of the common flu could kill millions. Its not likely but its possible.
 Originally Posted by asplundii
And, as I said above, this flu is not even in the same class as the things that vid clip was describing. This flu was human in origin, NOT animal. Until recently it has only been spread human to human and the data on the infected pigs in Canada is not all in yet so we way be jumping the gun to say it has jumped species (and then we may not, I am waiting for the hard data.)
Again not disputing your point.
 Originally Posted by asplundii
Apples to oranges. Agricultural species, being predominantly homogeneous, have little genetic diversity putting them at a reduced fitness on the population scale.
What I was doing is comparing humans to bananas. Clearly you have done your homework. Do a bit more on human genetic diversity. You will find that humans are not genetically diverse when compared to other mammals. So I am sticking with my comparison.
-
-
Re: Swine Flu
 Originally Posted by Wh00h0069
Thank you for the link Eddie. There are some things in there that are not in agreement with other credible sources I have read so I will be following up on them.
 Originally Posted by Egapal
You really have a way of not taking into account the mutable nature of a virus strain.
Not so. I take the mutability of microorganisms into account daily to be honest. But I also take into account other factors involved... Like selective pressure. 
Odds are that an already established disease that is relatively mild will have a greater tendency to progress toward a more mild nature. The odds of it mutating into really nasty killer are much lower because the pressure to move that way is not there... Freak things do occur but odds are not in their favor
Diseases that we are good hosts for are not a big deal. We live with them, literally. Diseases we are a bad host for are of great concern.
You have my full agreement on that.
Comparing Ebola to the Flu is like comparing apples to oranges.
Yes, that is exactly what I was getting at. That vid clip is talking about things like Ebola. So trying to use it as a comparison to this current flu outbreak is a flawed comparison.
The Flu is much easier to spread and takes much longer to kill in the rare cases that it does kill. The key point I am trying to make is that strains mutate.
I never contended they did not. There is a reason we need a new vaccine each year 
I more deadly form of the common flu could kill millions. Its not likely but its possible.
And I do not deny that either. I was not trying to debate what this flu or some other flu strain may or may not be capable of. Like I said above, I was more making the point that the content discussed in that vid clip was being misapplied to tis flu conversation.
What I was doing is comparing humans to bananas. Clearly you have done your homework. Do a bit more on human genetic diversity. You will find that humans are not genetically diverse when compared to other mammals. So I am sticking with my comparison.
Granted I may have missed it since human genetics is not in my primary field but I do not recall a study showing the global diversity of the human genome. If you have a reference I would love to read it. I have seen a number of population level studies using specific SNPs that showed high levels of homogeneity of those SNPs within the populations but beyond that I am not sure there are even enough complete human genomes from enough regions of the world to be able to make a full global comparison.
Cheers
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Swine Flu
 Originally Posted by asplundii
Not so. I take the mutability of microorganisms into account daily to be honest. But I also take into account other factors involved... Like selective pressure.
Odds are that an already established disease that is relatively mild will have a greater tendency to progress toward a more mild nature. The odds of it mutating into really nasty killer are much lower because the pressure to move that way is not there... Freak things do occur but odds are not in their favor
The problem with your argument is that it only applies to the grand scheme of things. Selective pressure implies that random mutation will create variations some that are more deadly and some that are less. 1000 years from now the ones that are less deadly will still be around and the ones that are more deadly will not. That's not relevant to the argument though. If a more deadly strain wipes out mankind and thus burns its self out you will have made a valuable point but we will all be dead. Odds are that an established disease will mutate randomly and the strains that kill to many hosts will die out progressing the disease toward a milder form. The more right you are, the more dead you are. One more time the PRESSURE you talk about is us all dieing.
I was never defending the video.
 Originally Posted by asplundii
Granted I may have missed it since human genetics is not in my primary field but I do not recall a study showing the global diversity of the human genome. If you have a reference I would love to read it. I have seen a number of population level studies using specific SNPs that showed high levels of homogeneity of those SNPs within the populations but beyond that I am not sure there are even enough complete human genomes from enough regions of the world to be able to make a full global comparison.Cheers
I have read a hand full of papers over the past few years but of course I can't produce links to them. I hate to use wiki as a reference but it is a great source because at the bottom are lots of good references.
http://en.wikipedia.org/wiki/Human_g...uman_variation
This area is of course still very actively being researched but all of the signs based on the various studies you mentioned are pointing toward not a whole lot of genetic diversity in humans. We are far from being a clonal population but we are not exactly genetically diverse. This is all my synthesis of papers I have read and my field is computer programming and server architecture so take it or leave it.
-
-
Re: Swine Flu
Wash your hands and please don't sneeze boogers into your shirt sleeve at the elbow. Those elbow boogers will be with you all day!
Stay healthy everyone. At least while thinking of the swine flu and washing your hands, you're not thinking of that $5 gallon of milk, $3 gas, and wasteful government spending.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|