Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,235

0 members and 2,235 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,069
Threads: 249,218
Posts: 2,572,789
Top Poster: JLC (31,651)
Welcome to our newest member, ColorblindChameleon
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 22
  1. #11
    BPnet Veteran
    Join Date
    09-24-2007
    Posts
    995
    Thanks
    0
    Thanked 93 Times in 76 Posts

    Re: recessive, co-dom, dominate

    It's like back in elementry school with the times tables! The fives are easy, and there are tricks for the nines, but most of them you just have to memorize.

  2. #12
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Images: 46
    Blog Entries
    2

    Re: recessive, co-dom, dominate

    Quote Originally Posted by rocky88 View Post
    No I'm not really looking for a list. I just want to be able to tell which ones are recessive, co-dom etc... All of you experienced bp people, if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc..... How do you know if it is recessive or co-dom, dom? Did you just learn to kinda memorize which are which and now it's just second nature. Or is there some kind of method behind knowing???? Sorry if I am confusing you and you cant figure out what I'm asking. I'm just so confused on the subject
    Yes, you just start to learn it over time. Your list above:

    recessive, dominant, recessive, recessive, recessive, co-dominant, dominant

    It's just spending lots of times on breeder's websites, getting books, going to Ralph's and NERD's sites which will tell you if a morph is recessive, dominate, co-dom.

    It does become second nature.

  3. #13
    BPnet Veteran
    Join Date
    04-11-2009
    Location
    Orlando,Fl
    Posts
    474
    Thanks
    56
    Thanked 92 Times in 84 Posts

    Re: recessive, co-dom, dominate

    another great recource,is SBP's site,which in his forums,he has photos and genetics of pretty much all the morphs,who created them,and genetics behind them,including combos
    1.0 blonde pastel,1.8 normal,1.1 het orange ghost 1.0 het butterscotch 0.1 het green ghost 0.1 het albino 0.1 rtb 0.1 yellow anaconda 1.0 borneo blood 1.0 albino burmese

  4. #14
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: recessive, co-dom, dominate

    Quote Originally Posted by rocky88 View Post
    if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc.....
    Quote Originally Posted by rabernet View Post
    Your list above:
    recessive, dominant, recessive, recessive, recessive, co-dominant, dominant

    Robin, if I am interpreting your answer correctly, you are stating that normal is dominant. This is not true.

    There are 2 things one needs to understand. First of all, clown, spider, and all the rest of the base morphs (not normal), refer to a single mutated gene. It may or may not require a pair to be visual, but it is just 2 copies of the same gene. Combos are obviously a different story, because they require more than one mutated gene. What many people do not realize is that normal is also a very different story. "Normal" actually refers to quite a few different genes, one normal gene on the clown locus, one different normal gene on the spider locus, yet another different gene on the albino locus, etc.

    Also, one should understand that genes are only dominant or recessive in relationship to other genes. I am not aware of any genes that work this way in BPs, but in corns, amelanistic is recessive compared to the normal gene on that locus. There is another gene, ultra, that is on the same locus. Ultra is also recessive compared to normal. However, amel and ultra are co-dominant to each other, and if you have a snake that has one of each, you get an ultramel. Most people will still say that amel (or ultra) is recessive, but that is not true in relationship to each other. In fact, it is impossible for them both to be recessive to each other.

    So, getting back to normal in BPs, whether normal is recessive, dominant, or co-dom depends on which normal gene you are referring to, and which mutated gene you are comparing it to. The normal gene on the clown locus is dominant to clown, but the normal gene on the spider locus is recessive to spider, and the normal gene on the pastel locus is co-dominant to pastel.
    Casey

  5. #15
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: recessive, co-dom, dominate

    Quote Originally Posted by RebelYell83 View Post
    another great recource,is SBP's site,which in his forums,he has photos and genetics of pretty much all the morphs,who created them,and genetics behind them,including combos
    Can you provide a link?
    Casey

  6. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: recessive, co-dom, dominate

    Quote Originally Posted by kc261 View Post
    Also, one should understand that genes are only dominant or recessive in relationship to other genes. I am not aware of any genes that work this way in BPs, but in corns, amelanistic is recessive compared to the normal gene on that locus. There is another gene, ultra, that is on the same locus. Ultra is also recessive compared to normal. However, amel and ultra are co-dominant to each other, and if you have a snake that has one of each, you get an ultramel. Most people will still say that amel (or ultra) is recessive, but that is not true in relationship to each other. In fact, it is impossible for them both to be recessive to each other.
    Actually the ultra and the amel are recessive because convention is the relationship of the mutant to the wild type (i.e. normal). Ultra and amel are recessive to the WT whether in homozygous or heterozygous pair. In terms of relationship to one another, ultra and amel are simply alternate alleles (which are indeed co-expressive). The closest example of this in BPs would be the BluEL complex or YB/Whirwind or Cinny/Black Pastel. In each of these the mutants are inc-dom to WT but allelic to the others within the group (i.e. Butter is allelic to Lesser is allelic to Mojave is allelic to Phantom is allelic to Russo.)

    So, getting back to normal in BPs, whether normal is recessive, dominant, or co-dom depends on which normal gene you are referring to, and which mutated gene you are comparing it to. The normal gene on the clown locus is dominant to clown, but the normal gene on the spider locus is recessive to spider, and the normal gene on the pastel locus is co-dominant to pastel.
    Wild type is neither recessive nor dominant nor co-dom. It is just a baseline by which mutations are measured against.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #17
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: recessive, co-dom, dominate

    Quote Originally Posted by asplundii View Post
    Actually the ultra and the amel are recessive because convention is the relationship of the mutant to the wild type (i.e. normal). Ultra and amel are recessive to the WT whether in homozygous or heterozygous pair. In terms of relationship to one another, ultra and amel are simply alternate alleles (which are indeed co-expressive). The closest example of this in BPs would be the BluEL complex or YB/Whirwind or Cinny/Black Pastel. In each of these the mutants are inc-dom to WT but allelic to the others within the group (i.e. Butter is allelic to Lesser is allelic to Mojave is allelic to Phantom is allelic to Russo.)



    Wild type is neither recessive nor dominant nor co-dom. It is just a baseline by which mutations are measured against.
    Hmmm. That is different than what I was taught in college. At least it is different than how I remember it; it was quite a few years ago.

    Do you happen to have any sources where I could study it and make sure I understand it properly?
    Casey

  8. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: recessive, co-dom, dominate

    Quote Originally Posted by kc261 View Post
    Hmmm. That is different than what I was taught in college. At least it is different than how I remember it; it was quite a few years ago.
    I would be more inclined to think it is more down to your Prof not being able to make the explanation clear. It is kind of a slippery thing to describe.

    Think of it this way; You are in the bottom of a well. Are you above or below?

    Most people just say you are "below" because they assume a default state where ground level is the baseline/reference point. The correct answer, however, is that the question as asked, without a reference point given, can not be answered. "Below" would be correct if you are using ground level as a reference but if you are using the center of the earth as a reference then you would be "above". Make sense?

    So it is with genetic relation. WT is the reference by which we judge whether a mutation is recessive, dominant or co-dom.

    Let us look at Pinstripe as an example. When an animal is carrying the mutant gene (be they heterozygous or homozygous for the condition) it appears different than the WT and it only takes one copy of the gene to bring this phenotype about. So Pin is dominant to WT. We do not say that WT is recessive to Pin because Pin is not the normal state of these animals. That is usually the point that catches people. It is true that the WT allele is recessive to the Pin allele but it is the WT allele that is the reference point by which we are judging the animal, not the mutant allele.

    Do you happen to have any sources where I could study it and make sure I understand it properly?
    Not off hand, just going off my old texts and classes and my day to day work. If you want I can dig up a specific text.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #19
    BPnet Veteran
    Join Date
    11-04-2008
    Posts
    214
    Thanks
    0
    Thanked 43 Times in 35 Posts

    Re: recessive, co-dom, dominate

    [QUOTE=asplundii;1043204]
    Think of it this way; You are in the bottom of a well. Are you above or below?

    Most people just say you are "below" because they assume a default state where ground level is the baseline/reference point. The correct answer, however, is that the question as asked, without a reference point given, can not be answered. "Below" would be correct if you are using ground level as a reference but if you are using the center of the earth as a reference then you would be "above". Make sense?
    [/I can QUOTE]
    Why would you use the center of the Earth as a reference point? It is impossible to be below the center of the Earth when you consider gravitational pull and that apart from gravity, there is no up, above, below, or under.
    The reference points (in relation to above or under), would be typical ground level, sea level, or the floor of the well as a modified ground level. Could it then be in relation to the level of the water?
    Haha, this is quite off the original topic.
    -Steven
    -Steven

  10. #20
    BPnet Veteran GenePirate's Avatar
    Join Date
    04-11-2009
    Location
    Coastal South Carolina
    Posts
    249
    Thanks
    92
    Thanked 101 Times in 73 Posts
    Images: 8

    Re: recessive, co-dom, dominate

    Quote Originally Posted by asplundii View Post
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    OK, I did a BLASTn and this sequence is fairly homologous to several genes in any number of creatures from humans to zebrafish to rice and a fair number of beasties in between. And asplundii is the species name for several different botanical forms. So spill, 'cause it's driving me crazy. What's the sequence?

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1