» Site Navigation
1 members and 1,849 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,069
Threads: 249,219
Posts: 2,572,797
Top Poster: JLC (31,651)
|
-
Re: recessive, co-dom, dominate
 Originally Posted by kc261
Also, one should understand that genes are only dominant or recessive in relationship to other genes. I am not aware of any genes that work this way in BPs, but in corns, amelanistic is recessive compared to the normal gene on that locus. There is another gene, ultra, that is on the same locus. Ultra is also recessive compared to normal. However, amel and ultra are co-dominant to each other, and if you have a snake that has one of each, you get an ultramel. Most people will still say that amel (or ultra) is recessive, but that is not true in relationship to each other. In fact, it is impossible for them both to be recessive to each other.
Actually the ultra and the amel are recessive because convention is the relationship of the mutant to the wild type (i.e. normal). Ultra and amel are recessive to the WT whether in homozygous or heterozygous pair. In terms of relationship to one another, ultra and amel are simply alternate alleles (which are indeed co-expressive). The closest example of this in BPs would be the BluEL complex or YB/Whirwind or Cinny/Black Pastel. In each of these the mutants are inc-dom to WT but allelic to the others within the group (i.e. Butter is allelic to Lesser is allelic to Mojave is allelic to Phantom is allelic to Russo.)
So, getting back to normal in BPs, whether normal is recessive, dominant, or co-dom depends on which normal gene you are referring to, and which mutated gene you are comparing it to. The normal gene on the clown locus is dominant to clown, but the normal gene on the spider locus is recessive to spider, and the normal gene on the pastel locus is co-dominant to pastel.
Wild type is neither recessive nor dominant nor co-dom. It is just a baseline by which mutations are measured against.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|