Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,340

2 members and 1,338 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,142
Posts: 2,572,364
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 49

Thread: Making a BEL.

Threaded View

  1. #21
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    You cannot "add colour" in a Butter/Mojave. Fire, when added to a BluEL will, as I mentioned above, be more likely to push you to a whiter snake without the dorsal stripe. Cinny, does not seem to do much one way or the other when added to a BluEL.

    In "dirty" BluELs (SuperPhantoms, Crystals, SuperMojaves, etc.) you can sometimes tweak pigmentation but it is almost always toward further lightening them. I cannot think of a "dirty" combo that I have seen where it was made darker...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (11-20-2022)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1