» Site Navigation
0 members and 1,353 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,098
Threads: 249,240
Posts: 2,572,925
Top Poster: JLC (31,651)
|
-
Questions on the African Egg eating snakes
Quick questions...
I've been looking at the African egg eating snake. Very interesting creature.
Can there be more than 1 in a terrarium/tank? I would think that since they eat eggs, they wouldn't bother each other, but I know what thinking and not facts gets you.
And I'm here in Nothern Va. where would I pick up quail eggs? I haven't seen any in the local grocery stores I visit, and would the eggs need to be
fresh or will refrigerated work it they are bought up to room temperature?
Thanks for any help.
Jeff
-
-
Cannibalism is not the only reason to not co-hab. You want to keep your snakes separated, except for breeding, because you don't want them passing illnesses to each other, unless you like doubling your vet bills.
Quail eggs can be purchased at most Asian markets, which should be plentiful in northern VA. I imagine the egg would have to be brought up to ambient temperature before your snake eats it.
-
The Following User Says Thank You to bcr229 For This Useful Post:
-
Registered User
-I don't personally own an African egg eating snake, this is just my 2 cents-
Snake Discovery on Youtube is probably the reptile Youtuber I trust the most. She has a few African egg eating snakes. I think this video would be helpful to you: https://www.youtube.com/watch?v=09iL57T3Mtw Once again, I've never owned this kind of snake. It seems like info about them on the internet is 1) difficult to find and 2) often contradictory to what other people say. However Emily (Snake Discovery) says in her experience it's fine to house them together, similarly to garter snakes. You should see if you can find any more info before just doing it though. But it may be difficult to find someone who's actually owned them. (Also I'm not saying this is necessarily my opinion, I'm just sharing some info I found!)
I have also heard that with egg eaters it's very important to make sure you have access to the eggs before getting one. Bcr229 was right about Asian markets often having quail eggs. Where you live likely has at least one of these markets. I live in a pretty rural area and we have one. But you should check in person that they have the eggs before assuming. Also I believe the eggs should be room temperature. Pretty sure you can store them outside of the fridge since you can even do that with chicken eggs you eat, but if you're worried you could refrigerate them and just take them out to become room temperature the day before you feed the snake or something like that.
Hopefully this helps a little? Haha I really don't know much about the egg eating snakes myself but they're a species I'm interested in owning someday so I've done a little research. Maybe you should reach out to a breeder or something since they'd know a lot more about keeping the snakes..? Good luck!
-
The Following 2 Users Say Thank You to royalreilly For This Useful Post:
Bogertophis (07-08-2019),Gocntry (07-05-2019)
-
I just happened to watch that video on Snake Discovery...very cool snakes for sure. I cannot imagine that these snakes could tell the difference (or would care) if
the eggs were fresh or refrigerated & then warmed to room temperature, but I would also add that many animals are more productive in certain seasons, so make
sure to ask (whether relying on an Asian market for your eggs, or other local sources) that they routinely have these eggs available year-round (& for roughly the
same price?). If certain seasons these eggs become scarce, the price could go up by quite a lot, or they might be totally unavailable at times.
Good luck, I hope you succeed & do keep us posted?
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: Questions on the African Egg eating snakes
 Originally Posted by bcr229
Cannibalism is not the only reason to not co-hab. You want to keep your snakes separated, except for breeding, because you don't want them passing illnesses to each other, unless you like doubling your vet bills.
Quail eggs can be purchased at most Asian markets, which should be plentiful in northern VA. I imagine the egg would have to be brought up to ambient temperature before your snake eats it.
thanks for the reply,
The illness part didn't even register, I was thinking pair from the same breeder, so they would have been exposed to each other and should be good
But doesn't mean 1 might get ill and pass it on.
There's a global food, and a Fresh Market here that should fit the description of Asian market, I need to go look there.
-
-
Re: Questions on the African Egg eating snakes
 Originally Posted by royalreilly
-I don't personally own an African egg eating snake, this is just my 2 cents-
Snake Discovery on Youtube is probably the reptile Youtuber I trust the most. She has a few African egg eating snakes. I think this video would be helpful to you: https://www.youtube.com/watch?v=09iL57T3Mtw Once again, I've never owned this kind of snake. It seems like info about them on the internet is 1) difficult to find and 2) often contradictory to what other people say. However Emily (Snake Discovery) says in her experience it's fine to house them together, similarly to garter snakes. You should see if you can find any more info before just doing it though. But it may be difficult to find someone who's actually owned them. (Also I'm not saying this is necessarily my opinion, I'm just sharing some info I found!)
I have also heard that with egg eaters it's very important to make sure you have access to the eggs before getting one. Bcr229 was right about Asian markets often having quail eggs. Where you live likely has at least one of these markets. I live in a pretty rural area and we have one. But you should check in person that they have the eggs before assuming. Also I believe the eggs should be room temperature. Pretty sure you can store them outside of the fridge since you can even do that with chicken eggs you eat, but if you're worried you could refrigerate them and just take them out to become room temperature the day before you feed the snake or something like that.
Hopefully this helps a little? Haha I really don't know much about the egg eating snakes myself but they're a species I'm interested in owning someday so I've done a little research. Maybe you should reach out to a breeder or something since they'd know a lot more about keeping the snakes..? Good luck! 
Thanks for the info.... My daughter watches Snake discovery on the Tv, So I'm familiar with her videos (haven't seen the egg eating one though)
I did notice she had an opposite sex pair in there, I wonder how 2 males / or 2 females would do? More research to do......
-
-
Re: Questions on the African Egg eating snakes
 Originally Posted by Bogertophis
I just happened to watch that video on Snake Discovery...very cool snakes for sure. I cannot imagine that these snakes could tell the difference (or would care) if
the eggs were fresh or refrigerated & then warmed to room temperature, but I would also add that many animals are more productive in certain seasons, so make
sure to ask (whether relying on an Asian market for your eggs, or other local sources) that they routinely have these eggs available year-round (& for roughly the
same price?). If certain seasons these eggs become scarce, the price could go up by quite a lot, or they might be totally unavailable at times.
Good luck, I hope you succeed & do keep us posted? 
Thanks for the input, Any info I acquire I will be sure to post up, This board has massive amounts of info, So hopefully I can give back a little too.
We (me and my daughter) currently have 2 ball pythons, and a corn snake, the first BP was a pet store purchase (and yep I learned that's a beginner mistake) the other 2 were adoptions from the local humane society, Which goes thru the local Petsmart too. They sell their own animals but work with the county animal shelter to help get all their animals adopted. Which is a good thing in my opinion.
-
The Following User Says Thank You to Gocntry For This Useful Post:
-
I will ante in as someone who has owned multiple egg eaters.
Yes, you absolutely can co-hab them. Just make sure there are lots of hides so each of them can find a place to call their own and you also want to keep an eye on them just to make sure one is not hogging all the food. My only caution would be that they breed really easy so you should be ready for babies if you co-hab which means either having ready access to finch eggs or being prepared to syringe feed.
As has been noted, you can pick up quail eggs from just about any international supermarket. One pack of 18 should be more than enough to get you through the year.
Other things I will add here:
-These animals are very fragile. I do not recommend handling them as it is all too easy to accidentally break/kink their spines
-Give them vertical space. They are best treated as semi-/fully arboreal. They climb. A LOT. I have outfit my cage with numerous finch nests because those are the preferred hides
-They need to be feed seasonally and sparingly. This should be a no-brainer - birds only breed during a very short period of the year so their food source is only available for a couple of months. If you are feeding weekly they will get obese
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
bcr229 (07-08-2019),Bogertophis (07-08-2019)
-
Re: Questions on the African Egg eating snakes
 Originally Posted by asplundii
I will ante in as someone who has owned multiple egg eaters.
Yes, you absolutely can co-hab them. Just make sure there are lots of hides so each of them can find a place to call their own and you also want to keep an eye on them just to make sure one is not hogging all the food. My only caution would be that they breed really easy so you should be ready for babies if you co-hab which means either having ready access to finch eggs or being prepared to syringe feed.
As has been noted, you can pick up quail eggs from just about any international supermarket. One pack of 18 should be more than enough to get you through the year.
Other things I will add here:
-These animals are very fragile. I do not recommend handling them as it is all too easy to accidentally break/kink their spines
-Give them vertical space. They are best treated as semi-/fully arboreal. They climb. A LOT. I have outfit my cage with numerous finch nests because those are the preferred hides
-They need to be feed seasonally and sparingly. This should be a no-brainer - birds only breed during a very short period of the year so their food source is only available for a couple of months. If you are feeding weekly they will get obese
Wow, this ^ ^ ^ ^ ^ is a SUPER informative post! Regrets that I had but one thanks to give...
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|