Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 593

1 members and 592 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 2 FirstFirst 12
Results 11 to 20 of 20
  1. #11
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,841
    Thanks
    535
    Thanked 476 Times in 377 Posts
    Images: 1

    Re: How leopard affect other genes

    Quote Originally Posted by JodanOrNoDan View Post
    From what I heard from Nerd, a "Super" Leopard was produced by someone, don't recall the name, but what is actually a homozygous dominant. No visual change, just produces 100% Leopards.

    Has something changed?
    I would say its along the lines of the super enchi, super banana, super ghi where the super doesn't change the appearance but merely the offspring are 100% visuals.

    Sent from my SM-G955U using Tapatalk
    1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
    0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown

  2. #12
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22

    Re: How leopard affect other genes

    and both are just so beautiful in their own rite.

    you and your babies are p much the reason i wanted to work with the Leopard gene, and why i chose one of your babies to be my Matriarch.

    you're an inspiration Deb!!!
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  3. The Following 2 Users Say Thank You to tttaylorrr For This Useful Post:

    Craiga 01453 (07-20-2018),the_rotten1 (07-21-2018)

  4. #13
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: How leopard affect other genes

    Quote Originally Posted by Turbo Serpent View Post
    I would say its along the lines of the super enchi, super banana, super ghi where the super doesn't change the appearance but merely the offspring are 100% visuals.

    Sent from my SM-G955U using Tapatalk
    All of those are co-doms.There is a visual difference in the "Supers". Leopard was dominant last time I heard.

    My snakes...

    Enchi...


    Super Enchi
    Honest, I only need one more ...

  5. The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:

    C.Marie (07-22-2018),the_rotten1 (07-23-2018)

  6. #14
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,841
    Thanks
    535
    Thanked 476 Times in 377 Posts
    Images: 1

    Re: How leopard affect other genes

    I've never really noticed much of a difference between enchi and super enchi, I always thought it to be the same.

    Sent from my SM-G955U using Tapatalk
    1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
    0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown

  7. #15
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    Amazing babies. I'm of the opinion that leopard makes everything better and this makes me want to add some lesser and coral glow to my collection. Your hatchlings are inspirational.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  8. The Following User Says Thank You to the_rotten1 For This Useful Post:

    Stewart_Reptiles (07-21-2018)

  9. #16
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: How leopard affect other genes

    Quote Originally Posted by the_rotten1 View Post
    Amazing babies. I'm of the opinion that leopard makes everything better and this makes me want to add some lesser and coral glow to my collection. Your hatchlings are inspirational.
    Thanks, Leopard has definitely become one of my favorite gene to work with since buying my first one in 2012, now all I have to do is incorporate it in my Clown stuff (which is on the way since this year I did Pastel Leopard Clown X Leopard)
    Last edited by Stewart_Reptiles; 07-21-2018 at 11:48 AM.
    Deborah Stewart


  10. The Following 4 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    AlexisFitzy (09-03-2018),C.Marie (07-22-2018),the_rotten1 (07-23-2018),tttaylorrr (07-21-2018)

  11. #17
    Registered User ceh23's Avatar
    Join Date
    10-28-2013
    Location
    VA
    Posts
    183
    Thanks
    27
    Thanked 96 Times in 73 Posts
    Images: 4

    Re: How leopard affect other genes

    Love the leopard morph and what it does. Awesome pics.


    Sent from my iPhone using Tapatalk
    https://www.morphmarket.com/us/searc...t=&layout=grid

    Instagram - CH_Reptiles_com
    My BPs -

    https://youtu.be/TZB9IFIq6-g - Albino and Coral Glow Pastel
    https://www.youtube.com/watch?v=yM612TpsTkk&t=7s - Pastel Lesser Het Clown
    https://youtu.be/XubMkeMBkPU - Killer Blast
    https://youtu.be/OF-x6Lt-OgQ - Super Pastel Het Clown
    https://youtu.be/XhbnRoMn1Sk - Pastel Clown

  12. The Following User Says Thank You to ceh23 For This Useful Post:

    Stewart_Reptiles (07-22-2018)

  13. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: How leopard affect other genes

    Quote Originally Posted by JodanOrNoDan View Post
    From what I heard from Nerd, a "Super" Leopard was produced by someone, don't recall the name, but what is actually a homozygous dominant. No visual change, just produces 100% Leopards.

    Has something changed?
    Graziani was the first to publicly comment on Leopard being a strict dominant type mutation with a homozygous that was not visually distinct from the heterozygous. He and I discussed it on ReptileRadio back in... I want to say early 2014.

    Kobylka has since put out a video wherein he said that he thinks there is a very subtle difference between the heterozygous and the homozygous, at least in some of the combos he has made. The trouble there is that all the animals he showed in the video were from Leo x Leo clutches and therefore only considered possibly homozygous and to the best of my knowledge neither he not anyone else has subsequently bred them out to confirm if his supposition was correct.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (07-23-2018)

  15. #19
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: How leopard affect other genes

    Quote Originally Posted by Deborah View Post
    Leopard has been listed has Dominant since it first appeared however Super Leopard have been produced.
    Quote Originally Posted by JodanOrNoDan View Post
    From what I heard from Nerd, a "Super" Leopard was produced by someone, don't recall the name, but what is actually a homozygous dominant. No visual change, just produces 100% Leopards.

    Has something changed?
    Quote Originally Posted by asplundii View Post
    Graziani was the first to publicly comment on Leopard being a strict dominant type mutation with a homozygous that was not visually distinct from the heterozygous. He and I discussed it on ReptileRadio back in... I want to say early 2014.

    Kobylka has since put out a video wherein he said that he thinks there is a very subtle difference between the heterozygous and the homozygous, at least in some of the combos he has made. The trouble there is that all the animals he showed in the video were from Leo x Leo clutches and therefore only considered possibly homozygous and to the best of my knowledge neither he not anyone else has subsequently bred them out to confirm if his supposition was correct.
    i asked this awhile back: https://ball-pythons.net/forums/show...pard&p=2535369 and here's the vid:



    Quote Originally Posted by Turbo Serpent View Post
    I would say its along the lines of the super enchi, super banana, super ghi where the super doesn't change the appearance but merely the offspring are 100% visuals.
    there are differences. i've noticed higher whites and softer colors overall in the Super Banana/Super CG and the Super GHI is super dark, looks to be in shed w/o the blue-ness.

    Quote Originally Posted by Turbo Serpent View Post
    I've never really noticed much of a difference between enchi and super enchi, I always thought it to be the same.
    the pattern is cleaner, bolder but the biggest difference is in the eyestripe and neck pattern.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  16. The Following 2 Users Say Thank You to Ax01 For This Useful Post:

    JodanOrNoDan (07-23-2018),Turbo Serpent (07-23-2018)

  17. #20
    Registered User Roux's Avatar
    Join Date
    06-22-2017
    Posts
    136
    Thanks
    40
    Thanked 70 Times in 52 Posts

    Re: How leopard affect other genes

    Wow that first banana looks like it has tri stripe in it! Very beautiful boy.

    Sent from my SM-G930V using Tapatalk

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1