Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,672

0 members and 1,672 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,098
Threads: 249,243
Posts: 2,572,932
Top Poster: JLC (31,651)
Welcome to our newest member, nightfallvt
Page 2 of 2 FirstFirst 12
Results 11 to 20 of 20
  1. #11
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Coral Glow Genetics

    Quote Originally Posted by Warren_Booth View Post
    Maybe we should be trying to promote the correct terminology also. Why on earth people maintain the use of co-dominant, when we know it is incomplete dominant (a very different thing) is absurd. But sadly I see it used in books like the one from NERD, World of Ball Pythons, etc. It takes no more effort to actually state it factually.

    Warren
    I agree. The terminology used in the hobby stinks, and it really gets nasty when people start mixing the proper terminology with the hobby terminology.

  2. #12
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Coral Glow Genetics

    Quote Originally Posted by Warren_Booth View Post
    Maybe we should be trying to promote the correct terminology also. Why on earth people maintain the use of co-dominant, when we know it is incomplete dominant (a very different thing) is absurd. But sadly I see it used in books like the one from NERD, World of Ball Pythons, etc. It takes no more effort to actually state it factually.

    Warren
    within the hobby it is not a very different thing.
    dom = het: visual change, homo: same change,
    both inc-dom and co-dom, het: visual change, homo: different visual change
    recessive het: no change, homo: visual change.
    Yes I do know the difference, but it really isn't that different comparatively to dom or recessive. I will agree there is no more effort to use correct terms. but you know those powers within the hobby...

  3. #13
    Registered User RoyaLoveRay's Avatar
    Join Date
    12-05-2013
    Posts
    51
    Thanks
    76
    Thanked 1 Time in 1 Post
    Images: 2

    Re: Coral Glow Genetics

    Quote Originally Posted by Warren_Booth View Post
    Maybe we should be trying to promote the correct terminology also. Why on earth people maintain the use of co-dominant, when we know it is incomplete dominant (a very different thing) is absurd. But sadly I see it used in books like the one from NERD, World of Ball Pythons, etc. It takes no more effort to actually state it factually.

    Warren
    So I take it that co-dominance is demonstrated by, for example, fires and leucistics, where the super fire, or leucistic, is dramatically different from the heterozygot. And so coral glows would demonstrate incomplete dominance, because the super form is just somewhat lighter. Am I correct?

  4. #14
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Coral Glow Genetics

    Quote Originally Posted by RoyaLoveRay View Post
    So I take it that co-dominance is demonstrated by, for example, fires and leucistics, where the super fire, or leucistic, is dramatically different from the heterozygot. And so coral glows would demonstrate incomplete dominance, because the super form is just somewhat lighter. Am I correct?
    no, co dominance displays both phenotypes in their entirety. For example if a normal looks normal and the super fire looks like a BlkEL. The fire would have parts that look normal and parts that look BlkEL. no mixing, no inbetween. A true co-dom would look like a paradox of some kind.

    The closest we come in ball pythons is scaleless/scaleless head. Normals are normal, Scaleless are scaleless and the scaleless head show scaleless and normal parts. If you inspect them closely though, scaleless heads also have smaller scales sometimes which is a mix between the two, so we really can't call it co-dom truly. but its the closest we got.

  5. The Following User Says Thank You to OhhWatALoser For This Useful Post:

    RoyaLoveRay (07-16-2017)

  6. #15
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    I know our snake genetics really don't line up with classical genetics. But I thought that if a snake carries one copy of the gene and it's not visual we call the gene 'recessive' and a recessive carrying two copies of the gene is called a 'visual'. If you can see differences in appearance when they carry one copy of the gene it's either 'co-dominant' (also called 'incomplete dominance) or dominant. As far as I understand it the dominant gene has no super form, it either does not exist or doesn't act as two copies of the gene where all offspring get one copy or it's a lethal combo having two copies of the gene, like the Spider gene.

    Also, if two morphs have genes at the same genetic location you can get an 'allelic' pairing of the genes, basically two different genes at the same location that act as a new form of super, like the Super Stripe.

    The coral glow male / female genetics is very interesting. The other gene that's very interesting is the purple / lavender / white albinos in reticulated pythons. In that case you can't get the purple gene separated from the albino gene. The purple is the super form, the lavender has one copy of the purple gene and the white has none, but it's linked to the albino gene, so you can't get a purple non-albino morph. That blows my mind!
    Last edited by cchardwick; 07-15-2017 at 08:48 AM.


  7. #16
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Coral Glow Genetics

    Quote Originally Posted by OhhWatALoser View Post
    no, co dominance displays both phenotypes in their entirety. For example if a normal looks normal and the super fire looks like a BlkEL. The fire would have parts that look normal and parts that look BlkEL. no mixing, no inbetween. A true co-dom would look like a paradox of some kind.

    The closest we come in ball pythons is scaleless/scaleless head. Normals are normal, Scaleless are scaleless and the scaleless head show scaleless and normal parts. If you inspect them closely though, scaleless heads also have smaller scales sometimes which is a mix between the two, so we really can't call it co-dom truly. but its the closest we got.
    A true codominant need not look like a paradox of some kind to the eye if the spotting effect is cellular. Example: Burmese, Tonkinese and Siamese cats. The Tonkinese is the heterozygote. The Burmese gene and Siamese gene produce different amounts of melanin in the color cells. The Tonkinese has less melanin than the Burmese cat and more melanin than the Siamese cat, producing an intermediate color.

    This is a confusing subject because I know of three definitions for codominant vs incomplete dominant:

    1. Each of the three possible gene pairs has its own phenotype. Codominant and incomplete dominant are synonyms.

    2. Each of the three possible gene pairs has its own phenotype. In incomplete dominance, the heterozygote's phenotype is roughly intermediate between the two homozygote phenotypes. In codominance, the heterozygote's phenotype is a mixture of the two homozygote phenotypes, and both can be distinguished in the heterozygote. Example: four o'clock flowers (ID) and human blood types A, B, and AB (CD).

    3. Each of the three possible gene pairs has its own phenotype. In incomplete dominance, one allele produces a functional product and the other produces a nonfunctional product. The difference between the three phenotypes is caused by the amount of product produced. In codominance, both alleles produce a functional product, and the heterozygote's phenotype is produced by the mixture of products. Example: four o'clock flowers (ID) and human blood types A, B, and AB (CD).

    Anybody care to add another definition?

    Definition number 3 is out because we generally don't know whether a given gene produces a functional product.

    Definition number 2 is hard to teach because we have to teach three terms--incomplete dominance, codominance and overdominance (the heterozygote's phenotype is outside the range bounded by the two homozygotes' phenotypes). Overdominance is rare, but we have to include it for completeness. By the way, overdominance has other definitions.

    Definition number 1 is the simplest and easiest to teach and use for beginning genetics students. IMO, most herpers would be classified among beginning genetics students.

    There is no one to one correspondence between the above definitions. Is the Burmese/Tonkinese/Siamese cat example incomplete dominance (def 2) or codominance (def 3)? And one pair of alleles can be classified different ways using different tests.

  8. #17
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Coral Glow Genetics

    Quote Originally Posted by cchardwick View Post
    I know our snake genetics really don't line up with classical genetics. But I thought that if a snake carries one copy of the gene and it's not visual we call the gene 'recessive' and a recessive carrying two copies of the gene is called a 'visual'. If you can see differences in appearance when they carry one copy of the gene it's either 'co-dominant' (also called 'incomplete dominance) or dominant. As far as I understand it the dominant gene has no super form, it either does not exist or doesn't act as two copies of the gene where all offspring get one copy or it's a lethal combo having two copies of the gene, like the Spider gene.

    Also, if two morphs have genes at the same genetic location you can get an 'allelic' pairing of the genes, basically two different genes at the same location that act as a new form of super, like the Super Stripe.

    The coral glow male / female genetics is very interesting. The other gene that's very interesting is the purple / lavender / white albinos in reticulated pythons. In that case you can't get the purple gene separated from the albino gene. The purple is the super form, the lavender has one copy of the purple gene and the white has none, but it's linked to the albino gene, so you can't get a purple non-albino morph. That blows my mind!
    Here is the difference between a snake with two copies of a dominant mutant gene and a snake with one copy of a dominant mutant gene. A snake with two copies of a dominant mutant gene mated to a normal snake give different results than a snake with one copy of a dominant mutant gene mated to a normal snake.

    Two copies of a dominant mutant gene x two copies of the normal gene produce 100% babies with one copy of the dominant mutant gene paired with one copy of the normal gene (dominant mutant/normal gene pair).

    Dominant mutant/normal gene pair x normal/normal gene pair produces
    50% dominant mutant/normal gene pair
    50% normal/normal gene pair (normal appearance)

    Standard genetics uses the term "multiple alleles" when two mutant genes can make a gene pair. For example, the lesser gene and the mojave gene are different mutant genes that can make a gene pair. A geneticist would call a snake with a mojave gene paired with a lesser gene heterozygous because the two genes are not the same.

    As far as I can tell from reading various forums, purple / lavender / white albinos in reticulated pythons is another case of multiple alleles. In mice and fruit flies, there are cases of over two dozen mutant genes in a set of alleles.

  9. #18
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Coral Glow Genetics

    Quote Originally Posted by cchardwick View Post
    I know our snake genetics really don't line up with classical genetics. But I thought that if a snake carries one copy of the gene and it's not visual we call the gene 'recessive' and a recessive carrying two copies of the gene is called a 'visual'. If you can see differences in appearance when they carry one copy of the gene it's either 'co-dominant' (also called 'incomplete dominance) or dominant. As far as I understand it the dominant gene has no super form, it either does not exist or doesn't act as two copies of the gene where all offspring get one copy or it's a lethal combo having two copies of the gene, like the Spider gene.
    Every morph has a super form. Dominant just means the heterozygous (het) and homozygous (super) forms look the same. Difference you will notice is when breed to a normal, the super will produce 100% of that morph. A homozygous lethal is still incomplete dominant, just happens to not be viable.


    Quote Originally Posted by paulh View Post
    A true codominant need not look like a paradox of some kind to the eye if the spotting effect is cellular. Example: Burmese, Tonkinese and Siamese cats. The Tonkinese is the heterozygote. The Burmese gene and Siamese gene produce different amounts of melanin in the color cells. The Tonkinese has less melanin than the Burmese cat and more melanin than the Siamese cat, producing an intermediate color.
    I would argue, the exact effect that is going on at the cellar level would determine if it was true co-dom or not, actual intermediate production vs splotches of higher and lower production. Either way it would probably look the same to the naked eye. That of course also depends on which definition you use also
    Last edited by OhhWatALoser; 07-16-2017 at 08:01 AM.

  10. #19
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Quote Originally Posted by cchardwick View Post
    I know our snake genetics really don't line up with classical genetics.
    <Sigh>

    I have said this so many times… Genetics is genetics is genetics. There is literally nothing about the genetics of our snakes that is different from the genetics of any other organism. This myth the “ball python genetics” or “snake genetics” is something totally and completely different than the genetics of everything else in the world is ridiculous.


    Quote Originally Posted by cchardwick View Post
    Also, if two morphs have genes at the same genetic location you can get an 'allelic' pairing of the genes, basically two different genes at the same location that act as a new form of super, like the Super Stripe.
    Close… But not quite.

    An allele is just an alternate form of a gene. So there are not two different genes and the locus, there are just different mutations of the same gene at the locus. And you get heteroallelic superforms when two of those mutant alleles are in the same animal – SuperStripe, Onyx, MysticPotion, etc.


    Quote Originally Posted by cchardwick View Post
    The other gene that's very interesting is the purple / lavender / white albinos in reticulated pythons. In that case you can't get the purple gene separated from the albino gene. The purple is the super form, the lavender has one copy of the purple gene and the white has none, but it's linked to the albino gene, so you can't get a purple non-albino morph. That blows my mind!
    What is happening in the Purple/Lav/White retics is no different from what we have with Candy/’Ino/Albino in ball pythons; two alleles of the same gene. The Purple retics are the equivalent of Candy balls while the Whites are just Albinos. And then the Lavs are one copy of Purple with one copy of White the same way ‘Ino is one copy of Candy with one copy of Albino.


    Quote Originally Posted by paulh View Post
    Example: Burmese, Tonkinese and Siamese cats. The Tonkinese is the heterozygote. The Burmese gene and Siamese gene produce different amounts of melanin in the color cells. The Tonkinese has less melanin than the Burmese cat and more melanin than the Siamese cat, producing an intermediate color.
    This is not quite an example of incomplete dominance as both alleles in this situation are recessive. This is simply heteroallelism, not particularly different than the Purple/Lav/White retic versus Candy/’Ino/Albino balls I discussed above


    Quote Originally Posted by paulh View Post
    This is a confusing subject because I know of three definitions for codominant vs incomplete dominant:

    1. Each of the three possible gene pairs has its own phenotype. Codominant and incomplete dominant are synonyms.
    I disagree here. In the field they are two completely separate conditions and are not considered synonymous with one another. It is only within the hobby that the line has been blurred, historically by Big Names, such that they are now considered one and the same.


    Quote Originally Posted by paulh View Post
    2. Each of the three possible gene pairs has its own phenotype. In incomplete dominance, the heterozygote's phenotype is roughly intermediate between the two homozygote phenotypes. In codominance, the heterozygote's phenotype is a mixture of the two homozygote phenotypes, and both can be distinguished in the heterozygote. Example: four o'clock flowers (ID) and human blood types A, B, and AB (CD).
    3. Each of the three possible gene pairs has its own phenotype. In incomplete dominance, one allele produces a functional product and the other produces a nonfunctional product. The difference between the three phenotypes is caused by the amount of product produced. In codominance, both alleles produce a functional product, and the heterozygote's phenotype is produced by the mixture of products. Example: four o'clock flowers (ID) and human blood types A, B, and AB (CD). [/QUOTE]

    These are the same definition, simply differentiating them on the macro- versus micro- level. I would also argue that, in you latter definition, the mutant allele need not be non-functional as it can also be hyper-functional and alternatively functional.


    Quote Originally Posted by paulh View Post
    Anybody care to add another definition?
    Codominance is determined by the interplay of two distinct simple dominant type alleles of a given gene irrespective of recessive alleles of that same gene. We see this very clearly with blood types:

    A person with Type A blood can either be genetically AA or Ao; The A allele is simple dominant
    A person with Type B blood can either be genetically BB or Bo; The B allele is simple dominant

    Now when we look at the heteroallelic combination of Type AB blood, the individual is genetically AB. In this situation, dominant allele A is coexpressed with dominant allele B. Which is to say that the two simple dominant alleles are codominant with each other

    Any given allele, by itself, cannot be codominant. It is only deemed to be codominant when viewed against its expression in the presence of some other dominant allele

    An incomplete dominant allele, on the other hand, is a state attributed to the direct nature of the mutant allele. In its heterozygous state it exerts an effect is expressed dominantly (i.e., an individual with the aberrant phenotype from carrying a single copy of the mutant allele produces offspring that are, statistically, half aberrant and half normal) but the full effect of the mutant allele is only exhibited in the homozygous state



    The closest example in the hobby – at least that I am aware of -- for what could be considered codominance is Spider and Blackhead. The Spider allele acts to turn down the level of black patterning while the Blackhead allele acts to turn up the black patterning. When these two alleles combine, their opposite and equal effects cancel each other out and return expression of the black pattering to normal.

    That said, the fact that both of these alleles have superforms (albeit a terminal one in the case of Spider) means they do not fit the classic definition of codominance as I described above.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #20
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Coral Glow Genetics

    Quote Originally Posted by asplundii View Post
    ....
    Quote Originally Posted by paulh
    "2. Each of the three possible gene pairs has its own phenotype. In incomplete dominance, the heterozygote's phenotype is roughly intermediate between the two homozygote phenotypes. In codominance, the heterozygote's phenotype is a mixture of the two homozygote phenotypes, and both can be distinguished in the heterozygote. Example: four o'clock flowers (ID) and human blood types A, B, and AB (CD)."
    3. Each of the three possible gene pairs has its own phenotype. In incomplete dominance, one allele produces a functional product and the other produces a nonfunctional product. The difference between the three phenotypes is caused by the amount of product produced. In codominance, both alleles produce a functional product, and the heterozygote's phenotype is produced by the mixture of products. Example: four o'clock flowers (ID) and human blood types A, B, and AB (CD).

    These are the same definition, simply differentiating them on the macro- versus micro- level. I would also argue that, in you latter definition, the mutant allele need not be non-functional as it can also be hyper-functional and alternatively functional.
    Right, definitions 2 and 3 are the same except changing from macro to micro level. However, that change can change classification. On the most macro level for the human sickle cell gene, we differentiate between sickle cell anemia at sea level altitude vs no sickle cell anemia. That makes the sickle cell gene recessive to the corresponding normal gene. On a micro level, protein electrophoresis, we can distinguish between the two different hemoglobin molecules, making sickle cell gene codominant to the normal gene.

    And going from macro to micro changes the Burmese/Tonkinese/Siamese cat example from a case of incomplete dominance to a case of codominance.

    By the why, I am including "hyperfuctional" as a subset of "functional" for the purpose of definition 3 in the quote.

    Quote Originally Posted by asplundii View Post
    Codominance is determined by the interplay of two distinct simple dominant type alleles of a given gene irrespective of recessive alleles of that same gene. We see this very clearly with blood types:

    A person with Type A blood can either be genetically AA or Ao; The A allele is simple dominant
    A person with Type B blood can either be genetically BB or Bo; The B allele is simple dominant

    Now when we look at the heteroallelic combination of Type AB blood, the individual is genetically AB. In this situation, dominant allele A is coexpressed with dominant allele B. Which is to say that the two simple dominant alleles are codominant with each other

    Any given allele, by itself, cannot be codominant. It is only deemed to be codominant when viewed against its expression in the presence of some other dominant allele
    I agree with those last two sentences, except I'd remove the "dominant". Any given allele, by itself, cannot be codominant. It is only deemed to be codominant when viewed against its expression in the presence of some other allele. A/B/AB blood types are a case of heteroallelism where both alleles produce functional products. The Burmese/Tonkinese/Siamese cat example is also a case of heteroallelism where both alleles produce functional products. Whether the genes are dominant or recessive to a third gene is irrelevant. Which makes the cats an example of codominance.

    If a third gene is relevant, then codominance can only occur in cases of multiple alleles, and only a subset of multiple alleles at that.

    Quote Originally Posted by asplundii View Post
    An incomplete dominant allele, on the other hand, is a state attributed to the direct nature of the mutant allele. In its heterozygous state it exerts an effect is expressed dominantly (i.e., an individual with the aberrant phenotype from carrying a single copy of the mutant allele produces offspring that are, statistically, half aberrant and half normal) but the full effect of the mutant allele is only exhibited in the homozygous state.
    Pinstripe in ball pythons is classed as a dominant mutant gene. A pinstripe ball python has the aberrant phenotype and a gene pair made up of a pinstripe gene and a normal gene, thus it carries a single copy of the mutant allele. It produces offspring (when mated to a normal ball python) that are, statistically, half aberrant and half normal. But a pinstripe ball python looks like a super (AKA homozygous) pinstripe. The full effect (at least to the eye) is present in both the homozygous and heterozygous forms. Hmm. There seems to be something incorrect about the definition in the quote.

    Quote Originally Posted by asplundii View Post
    The closest example in the hobby – at least that I am aware of -- for what could be considered codominance is Spider and Blackhead. The Spider allele acts to turn down the level of black patterning while the Blackhead allele acts to turn up the black patterning. When these two alleles combine, their opposite and equal effects cancel each other out and return expression of the black pattering to normal.

    That said, the fact that both of these alleles have superforms (albeit a terminal one in the case of Spider) means they do not fit the classic definition of codominance as I described above.
    As we don't know whether one of these two mutant genes lacks a functional product, we don't know whether this is codominance or incomplete dominance. And that is the point I am trying to make. Snake mutant genes have not been adequately studied. With very few exceptions, we lack the information to accurately classify a given mutant as an incomplete dominant or a codominant. That is why I prefer using codominance in an all-inclusive sense, as suggested in the following quote:
    "In his law of dominance, Mendel did not accommodate different degrees of dominance. As such examples were discovered (Bateson 1913), various new terms were introduced. Within and between textbooks of genetics definitions are inconsistent. Various names have been used: partial dominance, incomplete dominance, codominance, lack or absence of dominance, intermediate dominance, imperfect dominance, egalitarian dominance, and transdominance. The definitions vary from text to text and depend on interpretation of allelic function, although an allele’s function is seldom known and often must be assumed. In all these usages there is one consistent aspect; each genotype has a distinguishable phenotype, and the genotype may be inferred from the phenotype. Perhaps none of the terms that have been used are all-inclusive, but some such term is desirable for teaching purposes. We have chosen the term codominance as simplest, shortest, and adequately inclusive. One can still use specialized sub-definitions for well-analyzed cases. In our more that 20 years of teaching this method has worked well." Miller & Hollander. 1995. Three neglected advances in classical genetics. BioScience 45(2): 98-104

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1