Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 617

1 members and 616 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,201
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 2 FirstFirst 12
Results 11 to 16 of 16
  1. #11
    BPnet Veteran cinderbird's Avatar
    Join Date
    08-20-2007
    Location
    Silver Spring, MD
    Posts
    2,170
    Thanks
    551
    Thanked 480 Times in 363 Posts
    Images: 4

    Re: the only dumb question.....

    Quote Originally Posted by GenePirate View Post
    This is an excellent question. Glad you asked. I don't think the answer is as easy as it seems.



    Sorry, Rebel, didn't mean to kill your Friday. This is a topic that I started working on with Greg Graziani a year or so ago, but I dropped the ball because I got overwhelmed in trying to find contract electron microscopy laboratories that didn't charge a "caramel glow" for a couple of pics. Actually, its not THAT expensive, but still beyond my budget right now.
    You should have posted here if you were looking for some SEM imaging. I have access to one, for free.

  2. #12
    BPnet Veteran GenePirate's Avatar
    Join Date
    04-11-2009
    Location
    Coastal South Carolina
    Posts
    249
    Thanks
    92
    Thanked 101 Times in 73 Posts
    Images: 8

    Re: the only dumb question.....

    Quote Originally Posted by Spaniard View Post
    Wow I need to break out my VPI book and re-read that Skin and Color section...my head-o-phores are going to explode!
    Head-o-phores--that's classic! LOL I won't soon forget that one!

  3. #13
    BPnet Veteran Lucas339's Avatar
    Join Date
    10-08-2008
    Location
    Fort Pierce
    Posts
    2,104
    Thanks
    158
    Thanked 389 Times in 366 Posts
    Images: 2

    Re: the only dumb question.....

    i need to pick up this VPI book. does it cover pigmentation and how its expressed in the different morphs?

  4. #14
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: the only dumb question.....

    My book is in my desk at work, so when I get in on monday I will look through it and see. Nothing in detail, that much I can remember. Its a beautiful book though lots of great pictures and good information. Well worth the $75 bucks IMO.
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  5. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: the only dumb question.....

    Quote Originally Posted by tonkatoyman View Post
    That was clear as mud but it does cover the ground However I'm so glad there are people out there researching our industry. This can only be good for all of us. By the way you already bent my brain
    Sorry I bent your brain and was clear as mud, I do tend to lapse into jargon when I am talking with someone who is in my field.

    I can work to keep it at a more layman level if you like.

    Quote Originally Posted by kc261 View Post
    I can't quite follow all of what gene pirate and asplundii are talking about, but I will say it sure is refreshing to see a thread that goes a lot deeper than "if I pair my het pied with my pastel, will I get pastel pieds?"

    Thanks guys!
    Always glad to hear that people appreciate the deep stuff even if it is a little jargon filled. Thanks

    Quote Originally Posted by GenePirate View Post
    Knew I could count on you. I'll think more about what you said this weekend, too, and get back with you.
    Well, I thought on it and I did not come up with a lot more. Considering all the types of albino (T- and all the different T+) I am leaning more toward my speculation that there is some character of the BP melanin itself that lends to the overall reddish tint on the animals. I do not know how best to articulate my reasoning but the lack of any red cast in the T- albino but the obvious purple/red hue to the various T+ albinos just makes me lean toward that being the most likely explanation.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #16
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: the only dumb question.....

    Quote Originally Posted by Lucas339 View Post
    i need to pick up this VPI book. does it cover pigmentation and how its expressed in the different morphs?
    Hey Lucas,

    I checked my book and they do not go over how the pigmentation is expressed in morphs. They do you a couple pages worth of information on melanophores, xanthophores, and iridophores.
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1