Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 433

0 members and 433 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,069
Threads: 249,219
Posts: 2,572,797
Top Poster: JLC (31,651)
Welcome to our newest member, ColorblindChameleon
Page 6 of 6 FirstFirst 123456
Results 51 to 58 of 58

Thread: Swine Flu

  1. #51
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Quote Originally Posted by Egapal View Post
    The problem with your argument is that it only applies to the grand scheme of things.
    No to sound obtuse but how is applying the grand scheme of things, which is the world we live in, a problem?

    Selective pressure implies that random mutation will create variations some that are more deadly and some that are less. 1000 years from now the ones that are less deadly will still be around and the ones that are more deadly will not. That's not relevant to the argument though
    How is that not relevant to the argument? Again, I am not trying to be dense I just do not understand why you think the selective pressure toward avirulence is irrelevant.

    If a more deadly strain wipes out mankind and thus burns its self out you will have made a valuable point but we will all be dead.
    The odds of a more deadly strain burning up the entire population are slim though. Once the strain becomes more deadly it tends to burn up the local pocket and then die out because it can not spread.

    Odds are that an established disease will mutate randomly and the strains that kill to many hosts will die out progressing the disease toward a milder form.
    Exactly. That is what I said but you said it was irrelevant. So where is our communication break down? Cause we seem to be saying the same thing...

    The more right you are, the more dead you are.
    I do not understand this statement. How does my being correct lead to my being dead? (Also, and yes I am just nitpicking, you can not be "more" dead. You either are dead or you are not LOL )

    One more time the PRESSURE you talk about is us all dieing.
    Not so. There are numerous pressures that drive an organism down a given path. One pressure that keeps virulence down is the hotter strains dropping hosts before being passed on. Another pressure is that the strains that cause the least amount of debilitation are the ones most likely to be passed on. Both are selective pressures, it is just that one is a pressure against while the other is a pressure for. The latter type need not kill anyone to get to the ideal host/pathogen relationship: infection, amplification and spread without any actual disease.

    I was never defending the video.
    I apologize for the misunderstanding on that front. You contended statements I was making in the refutation of that vid clip as it was being applied to this flu outbreak and so I assumed you were defending it.

    I have read a hand full of papers over the past few years but of course I can't produce links to them. I hate to use wiki as a reference but it is a great source because at the bottom are lots of good references.
    http://en.wikipedia.org/wiki/Human_g...uman_variation
    This area is of course still very actively being researched but all of the signs based on the various studies you mentioned are pointing toward not a whole lot of genetic diversity in humans. We are far from being a clonal population but we are not exactly genetically diverse. This is all my synthesis of papers I have read and my field is computer programming and server architecture so take it or leave it.
    I take Wiki with a grain of salt but I'll run the refs and see if they produce any additional by plugging them through PubMed.

    I am always willing to take in new info, regardless of the source. Like I said, human genetics is not my primary field so papers on that get about third or fourth billing in my stacks of reading material. I still think we do not have enough full sequences to make a call on the homogeneity of the species but there could be a paper or 3 out there that will prove that assumption wrong.

    Cheers
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #52
    BPnet Veteran Egapal's Avatar
    Join Date
    09-28-2008
    Location
    Upstate New York
    Posts
    689
    Thanks
    59
    Thanked 213 Times in 138 Posts
    Images: 8

    Re: Swine Flu

    Quote Originally Posted by asplundii View Post
    No to sound obtuse but how is applying the grand scheme of things, which is the world we live in, a problem?
    Your logic applies to the grande scheme of the planet not the grande scheme of human life.

    Quote Originally Posted by asplundii View Post
    How is that not relevant to the argument? Again, I am not trying to be dense I just do not understand why you think the selective pressure toward avirulence is irrelevant.
    I don't mean to be condescending but, because that's not how selective pressure works. Selective pressure toward avirulence is based on the idea that deadly strains will die out when they kill their hosts. So if we all die then so will the deadly strain. If we don't all die then there is no selective pressure toward avirulence.

    Quote Originally Posted by asplundii View Post
    The odds of a more deadly strain burning up the entire population are slim though. Once the strain becomes more deadly it tends to burn up the local pocket and then die out because it can not spread.
    Yeah not disputing that. The problem is that the size of the pocket is based on how long it takes to kill the host and how noticeable the symptoms are. A more deadly version of the flu could become world wide being transmitted by humans aboard aircraft.

    Of course we won't all die but 25% of us dieing is kind of a big deal.

  3. #53
    BPnet Veteran Egapal's Avatar
    Join Date
    09-28-2008
    Location
    Upstate New York
    Posts
    689
    Thanks
    59
    Thanked 213 Times in 138 Posts
    Images: 8

    Re: Swine Flu

    Quote Originally Posted by asplundii View Post
    Exactly. That is what I said but you said it was irrelevant. So where is our communication break down? Cause we seem to be saying the same thing...
    Because in this scenario we are the hosts.


    Quote Originally Posted by asplundii View Post
    I do not understand this statement. How does my being correct lead to my being dead? (Also, and yes I am just nitpicking, you can not be "more" dead. You either are dead or you are not LOL )
    Not you personally, you as in humans. Ok so imagine where you live is the pocket in question. You see if everyone where you live dies then sure you are right. Future generations will be lucky that the disease got less deadly due to selective pressure, but you are dead in this scenario. Thats bad.



    Quote Originally Posted by asplundii View Post
    Not so. There are numerous pressures that drive an organism down a given path. One pressure that keeps virulence down is the hotter strains dropping hosts before being passed on. Another pressure is that the strains that cause the least amount of debilitation are the ones most likely to be passed on. Both are selective pressures, it is just that one is a pressure against while the other is a pressure for. The latter type need not kill anyone to get to the ideal host/pathogen relationship: infection, amplification and spread without any actual disease.
    lets assume for the sake of the argument that I understand the concepts you are talking about. I am not talking about the disease 20 years from now. I am not worried about catching the disease you are talking about. I am worried about the weird mutant disease that only lasts a month but manages to take out 50% of humans on the planet in that month.

  4. #54
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Quote Originally Posted by Egapal View Post
    Your logic applies to the grande scheme of the planet not the grande scheme of human life.
    Human life does not exist in a void nor do humans on an individual or collective basis. The actions and interactions take place on the planet and so the grand scheme of the planet must apply...

    I don't mean to be condescending but, because that's not how selective pressure works.
    Quite the contrary that is exactly how selective pressure works.

    Selective pressure toward avirulence is based on the idea that deadly strains will die out when they kill their hosts. So if we all die then so will the deadly strain. If we don't all die then there is no selective pressure toward avirulence.
    Again I tell you that your example is just one means by which selective pressure can push an organism toward avirulence but it is not the sole means. There is always more than one way to skin a cat. That is why we have convergence.

    Yeah not disputing that. The problem is that the size of the pocket is based on how long it takes to kill the host and how noticeable the symptoms are. A more deadly version of the flu could become world wide being transmitted by humans aboard aircraft.
    The odds of a hyperflu spontaneously evolving a spreading to every person on the planet via the jumbo jet vector all before patient zero dies are astronomically small (approaching zero.) The first pocket is often the largest but once it is recognized that something really nasty is out there the fire break system is quite effective at shutting the spread down.

    Of course we won't all die but 25% of us dieing is kind of a big deal.
    Never claimed a 25% death rate was not a big deal. But I honestly doubt we will see something as infective as the flu with a 25% or greater death rate make it to pandemic levels.

    Because in this scenario we are the hosts.
    So? It does not matter what the host is, the process is the same.

    Not you personally, you as in humans. Ok so imagine where you live is the pocket in question. You see if everyone where you live dies then sure you are right. Future generations will be lucky that the disease got less deadly due to selective pressure, but you are dead in this scenario. Thats bad.
    Obviously it sucks for me personally if I die but my death, on a population scale, is likely for the betterment of the species as a whole cause I take the virulent strain to the grave with me.

    lets assume for the sake of the argument that I understand the concepts you are talking about. I am not talking about the disease 20 years from now. I am not worried about catching the disease you are talking about. I am worried about the weird mutant disease that only lasts a month but manages to take out 50% of humans on the planet in that month.
    That is not going to happen. I do not have time to even begin on the math involved but to get an agent with a 100% infection rate of 50% of the global population with an ungodly long asymptomatic infectious phase followed by a sudden rapid death would take some type of engineering. A type of engineering that currently does not exist.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #55
    BPnet Veteran Egapal's Avatar
    Join Date
    09-28-2008
    Location
    Upstate New York
    Posts
    689
    Thanks
    59
    Thanked 213 Times in 138 Posts
    Images: 8

    Re: Swine Flu

    This is my last post on this topic.

    [QUOTE=asplundii;1051477]Human life does not exist in a void nor do humans on an individual or collective basis. The actions and interactions take place on the planet and so the grand scheme of the planet must apply...[quote]

    Yeah yeah yeah. You are making points that do not counter my points or support your own. I stipulate to the above. I am arguing your initial point that the odds of mutating into a more deadly form are lower do to selective pressure. I fundamentally disagree. [Mutation is random. selective pressure is about the success of those mutations toward the goal of keeping the strain alive. A mutation that makes the strain less likely to survive in the long term is more of a concern for us as humans because us dying is one thing that could make the particular mutated strain less viable.] Unless you disagree with that statement right there I am not sure what you are getting at.


    Quote Originally Posted by asplundii View Post
    Again I tell you that your example is just one means by which selective pressure can push an organism toward avirulence but it is not the sole means. There is always more than one way to skin a cat. That is why we have convergence.
    Again I stipulate to your above point. However I am talking about one way to skin a cat, mentioning another is not really progressing the argument. Did I mention we could all die by a alien attack or by a collision from space. See I hadn't brought it up cause its not relevant.

    Quote Originally Posted by asplundii View Post
    The odds of a hyperflu spontaneously evolving a spreading to every person on the planet via the jumbo jet vector all before patient zero dies are astronomically small (approaching zero.) The first pocket is often the largest but once it is recognized that something really nasty is out there the fire break system is quite effective at shutting the spread down.
    I again stipulate to your above statement. What are the odds of hyperflu spontaneously evolving and spreading to anyone on the planet that I care about. That's what I and most people are concerned with.

    Quote Originally Posted by asplundii View Post
    Never claimed a 25% death rate was not a big deal. But I honestly doubt we will see something as infective as the flu with a 25% or greater death rate make it to pandemic levels.
    I honestly doubt that as well. I am not wearing a mask right now or anything. I am saying it could happen, and it would be a big deal, and the chance of it happening is pretty high up there on the list of things that can ruin a perfectly good month.

    Quote Originally Posted by asplundii View Post
    So? It does not matter what the host is, the process is the same.
    Well for starters I won't cry as much if my snake or cat dies as I will if my mom or even cousin were to die.

    Quote Originally Posted by asplundii View Post
    Obviously it sucks for me personally if I die but my death, on a population scale, is likely for the betterment of the species as a whole cause I take the virulent strain to the grave with me.
    You are killing me. The majority of your posts are assuming that I don't understand the process. I get it really. From my very first post my entire point has been.

    Quote Originally Posted by Egapal View Post
    The problem is that the scientific community is worried for good reason. Cross species diseases can be particularly dangerous. They have proven how good they are at mutating and in some cases humans have limited or no immunity. So I am all for government and science getting ready but then the news gets involved and people panic. The public knowing everything is not always a good thing.

    I also totally agree with the sentiment that has been mentioned in this thread many times. Tens of thousands of death certificates every year have FLU written on them.
    Although the "Swine Flu" was not contracted from swine its still being debated whether or not it was spread to a swine, at least as far as I know.

    Quote Originally Posted by asplundii View Post
    Diseases tend to be very host specific and when they make the jump 99.999% of the time it is a dead end jump because the new host is not a fit environment for the disease.
    What exactly did you mean when you said the new host is not a fit environment? Could the host be a human in this scenario and could "not fit" mean dies to easy. Cause if both of those things are true then you are hardly helping the case you appear to be trying to make.

    Quote Originally Posted by asplundii View Post
    That is not going to happen. I do not have time to even begin on the math involved but to get an agent with a 100% infection rate of 50% of the global population with an ungodly long asymptomatic infectious phase followed by a sudden rapid death would take some type of engineering. A type of engineering that currently does not exist.
    You already stated this wasn't your field. Unless the math equals zero I hardly see how you can assert its not going to happen. It doesn't have to have a 100% infection rate. It doesn't even need an ungodly long asymptomatic infectious phase, and "sudden rapid death" is a relative term.

    Just for giggles whats the math on a disease with H1N1 infection rates, an H1N1 asymptomatic infectious phase and a mortality rate of around 5%. In 1918 it killed close to 1% of the humans on the planet. Now you may not be concerned with what I consider to be the very real, not 0%, chance of over 50 million people dying. Then again you may be concerned, its hard for me to tell. My point is that I am concerned, I don't think I am alone in my concern, and I think that its not a bad idea for governments to be prepared. I do however completely agree that the hysteria over the this latest outbreak was out of proportion with the facts.

  6. #56
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Quote Originally Posted by Egapal View Post
    This is my last post on this topic.
    I am sorry to hear that but that choice is yours

    Yeah yeah yeah. You are making points that do not counter my points or support your own.
    Funny, I am feeling the same way

    I stipulate to the above. I am arguing your initial point that the odds of mutating into a more deadly form are lower do to selective pressure. I fundamentally disagree.
    I never made that point. The point I have been trying to make (unsuccessfully it seems) was that the odds of a more deadly form, that had arisen through spontaneous mutation, of surviving to be a long term problem were lower due to the selective pressure against the more virulent form.

    [Mutation is random. selective pressure is about the success of those mutations toward the goal of keeping the strain alive.
    Which is what I have been saying all along...

    A mutation that makes the strain less likely to survive in the long term is more of a concern for us as humans because us dying is one thing that could make the particular mutated strain less viable.]
    This I disagree with however. Because you are making an assumption that it is an all or nothing thing. Either all of humanity dies or it does not. What happens is you get pocket burns. A few people die and that is it. Are those deaths of concern to some? Sure. But I refuse to believe for one minute that the entire population of the world is concerned about a hand full of people who die in Backwater Region, SE Asia... Hell, I would venture to guess that less than 1% of the population of the planet even give half a thought to the numbers of people who die of Ebola each year. The only reason people care about this flu is because the media hyped them into caring. And once the facts were/are known people will go back to not caring. Just like they did with SARS and WNV and Nipah and all the others.

    Unless you disagree with that statement right there I am not sure what you are getting at.
    Well you have my answers to the above. Maybe this time I have made my point clear. Then again maybe not...

    Again I stipulate to your above point. However I am talking about one way to skin a cat, mentioning another is not really progressing the argument. Did I mention we could all die by a alien attack or by a collision from space. See I hadn't brought it up cause its not relevant.
    There is no need to be condescending.

    You obviously missed the point I was making which was that there is more than one way by which selective pressure can act on an infective agent. If you have an infective agent and a chance mutation causes a subset to become more virulent (i.e. they kill) and that subset tends to be selected against (negative selective pressure). Those spontaneous mutations also have the potential to generate a subset that are less virulent (i.e. they cause a more mild form of the disease) and those tend to be spread further selecting for them (positive selection).

    Aliens and space collisions have not one whit to do with selective pressures on the flu (unless the aliens really do wipe us out and then there is nothing left for the flu to infect...)

    I again stipulate to your above statement. What are the odds of hyperflu spontaneously evolving and spreading to anyone on the planet that I care about.
    .

    Honestly, pretty slim.

    That's what I and most people are concerned with
    Not without the help of the media hype driving everyone to panic. Before this media circus just how worried that your mother might die from seasonal flu? I mean that seriously. It never crossed my mind to worry about my mother dying from the flu before this frenzy (and quite honestly it does not now.)

    I honestly doubt that as well. I am not wearing a mask right now or anything. I am saying it could happen, and it would be a big deal, and the chance of it happening is pretty high up there on the list of things that can ruin a perfectly good month.
    Getting hit by a semi can ruin a perfectly good month too and yet I get in my car and drive to and from work every day with out freaking out. So does most everyone else. And there is the rub. Getting hit by a semi is a "known quantity" which is why people can fob it off easily. But by and large people know very little about diseases so their reactions tend to swing to the far end of the pendulum when it comes to them. More so when fueled by hype.

    Well for starters I won't cry as much if my snake or cat dies as I will if my mom or even cousin were to die.
    Again with the condescension? Must we seriously go to the extreme?

    You missed my point entirely. You admit you will cry if your mother or cousin were to die. I have no doubt of that. But I am going to be really hard pressed to believe that you will shed a single tear if my mother or cousin dies.

    All of which is moot because we are (or at least I am) talking about a process and how it occurs, be it in humans or goats or fish or whatever and not how it personally affects us.

    From my very first post my entire point has been...
    And my stance at the outset was like yours: That the media hype was making this thing out to be so much more than it really was.

    Quote Originally Posted by asplundii View Post
    Long and short is that right now we are too early in the game to say just what is going to happen with it. I agree the media is hyping the heck out of this one like they always do. That said, the micro community is paying a lot more attention to this one than the avian bird flu that was all the news a few years ago and there are good reasons for that closer attention. Right now, I think it bears watching but the time for stockpiling the survival shelter is not even close to here.
    And then a vid clip was posted and the argument was made that the discussion in the vid clip applied to this flu and I disagreed and explained why and then you came in and refuted my disagreement with that vid clip and here we are on page 6 of this thread...

    Although the "Swine Flu" was not contracted from swine its still being debated whether or not it was spread to a swine, at least as far as I know
    That is correct but what does that have to do with the discussion at hand?

    What exactly did you mean when you said the new host is not a fit environment? Could the host be a human in this scenario and could "not fit" mean dies to easy.
    Yes

    Cause if both of those things are true then you are hardly helping the case you appear to be trying to make.
    That is the case I was trying to make. I think you are just failing to understand that point.

    You already stated this wasn't your field.
    No I did not. I said that human genetics was not my field. I never once said that microbiology was not my field...

    Unless the math equals zero I hardly see how you can assert its not going to happen.
    Yes, yes, in my rush because of lack of time I did not state that while anything is possible the odds against somethings are so small as to render them insignificant... Given enough time anything can happen.

    It doesn't have to have a 100% infection rate. It doesn't even need an ungodly long asymptomatic infectious phase, and "sudden rapid death" is a relative term.
    To be able to spread, unchecked, and get to a point where it could kill 50% of the population certain criteria would need to be met in order for the disease agent to succeed. Read up on the history of smallpox and how it was "eradicated" and you will understand what I am getting at.

    Just for giggles whats the math on a disease with H1N1 infection rates, an H1N1 asymptomatic infectious phase and a mortality rate of around 5%. In 1918 it killed close to 1% of the humans on the planet. Now you may not be concerned with what I consider to be the very real, not 0%, chance of over 50 million people dying.
    The 1918 H1N1 was a totally different bug than this one and there is some research that indicates that the flu itself may not have been the sole factor of the high mortality rates.

    Still and all, the 1918 flu illustrates my point. It was bad, I will never deny that. But as I sit here and type today it makes my point. It did not wipe us all out and in the end it was damped down to the point were it became just your typical seasonal flu, until it was displaced by the next pandemic strain...

    Then again you may be concerned, its hard for me to tell.
    I actually said I was watching this one close and I meant that. But I was holding off on jumping on the panic wagon till more data was in. I am still waiting on more data.

    My point is that I am concerned, I don't think I am alone in my concern
    I do not think you are either. I never thought that about you.

    and I think that its not a bad idea for governments to be prepared.
    You will not get any argument from me on this either.

    I do however completely agree that the hysteria over the this latest outbreak was out of proportion with the facts.
    And I was saying this from the beginning. Which was why I posted to refute the claim that that vid clip had any relevance to the situation at hand. Misapplication of data feeding the hype and hysteria.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #57
    BPnet Veteran Egapal's Avatar
    Join Date
    09-28-2008
    Location
    Upstate New York
    Posts
    689
    Thanks
    59
    Thanked 213 Times in 138 Posts
    Images: 8

    Re: Swine Flu

    Wow so I decided to take another look at this thread and wow. Having read your latest response, why won't you accept that points I am conceding. I completely accept that the odds of a more deadly disease surviving long are lower than a less deadly disease surviving long or a more deadly disease burning out quickly.

    I really don't understand how you disagree with my statement.

    A mutation that makes the strain less likely to survive in the long term is more of a concern for us as humans because us dying is one thing that could make the particular mutated strain less viable.
    Help me to understand by choosing the more concerning scenario. Again I am not talking odds. If one happens how concerned are you. Now if the other one happens how concerned. Now which was more. Again not which is more likely. I concede that a is more likely.

    a) A disease mutates into a less deadly form and subsequently infects 1 million people.

    b) A disease mutates into a more deadly form and subsequently infects 1 million people.

    I chose b. If you choose b then how is it that you don't agree with the quoted statement. I don't know where you got all that other stuff about assumptions I made. I understand the concept of localized infections that burn themselves out. I am not talking about those. We can not have a discussion unless we agree on what we are discussing.

    As for me being condescending when bring up aliens and space collisions. I am being condescending because you are not listening. How can you say I obviously missed your point when I am saying that I accept your point with open arms. I accept your point regarding negative selective pressure. My point is that one scenario is more concerning to me than another. You are talking about odds of those scenarios. I accept your odds. What do you have to say about my concerns.

    Before the media driven hype I was just as concerned about my mother dying from a superflu as I am now. I am not hyped up, I am a well informed individual. If we were talking about getting hit by a semi I would say thats a real concern and the results are devastating. As a precaution I would recommend not stepping out in front of Semi's. I would further recommend being sure that anything you do step out in front of is not a semi.

    Crying when mom dies vs snake. Yes we must go to extremes. Thats what I am talking about. I am right now talking about extremes. I won't cry if your mother or cousin cry unless either my mom or cousin die for the same reason. See thats what I am talking about.

    All of which is moot because we are (or at least I am) talking about a process and how it occurs, be it in humans or goats or fish or whatever and not how it personally affects us.
    Ok so here is the problem. I agree with you regarding the process. I am making points about how it affects us. So yeah we aren't talking about the same thing. I agree with you. What do you think about what I am saying?

    I am talking about how a less likely scenario is more concerning to me personally as well as humans as a whole than the more likely scenario that you keep talking about.

    Yup, I think the video applies because it demonstrates a less widespread version of a more deadly virus. You say the video doesn't apply because what I am talking about is even less likely than what is in the video. I agree with the odds entirely.

    Ok so this brings me to what you say here.

    Yes, yes, in my rush because of lack of time I did not state that while anything is possible the odds against somethings are so small as to render them insignificant... Given enough time anything can happen.
    I disagree with your assertion that the odds are so low as to make them insignificant. Lets put it in poker terms. Lets say you have a great hand and there is only one hand that can beat yours. The chances that your opponent has that had are slim to non. Your choice is simple, you bet the farm and chances are you win big. If on the other hand your opponent has that one better hand, you are devastated. Now, all I am saying is the man who makes the bet knowing he could lose is wise and the person who makes the bet thinking he can't lose is a fool. My field is server administration. When we look at risk analysis we put an event in a box. The box has 4 sides.

    1. Devastating if it happens.
    2. Going to happen often.
    3. Not a big deal if it happens.
    4. Never going to happen.

    We worry the most about things near the 1,2 corner and work our way toward the 3,4 corner.

    A super bug wiping out a significant portion of humanity lands close to the 1,4 corner. I am not trying to say that its in the 1,2 corner. I am just saying that the only things that we should blow off are the things in the 3,4 corner.

  8. #58
    Avian Life Neal's Avatar
    Join Date
    11-23-2008
    Location
    Louisiana
    Posts
    7,089
    Thanks
    603
    Thanked 2,147 Times in 1,560 Posts
    Images: 1
    Blog Entries
    8

    Re: Swine Flu

    I guess when it first came around earlier in the year, I kept up on what states it was in. Since then I haven't watched anything on it.
    -Birds-

    0.1 - Poicephalus senegalus - Stella (Senegal Parrot)
    0.1- Poicephalus rufiventris - Alexa (Red-bellied Parrot)



Page 6 of 6 FirstFirst 123456

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1