recessive, co-dom, dominate

I have been trying to read up on all the genetics that I can and one of the things that confuses me is that I dont know how to tell the difference between recessive, dominant, and co-dom. I was just curious if anyone knows of any good site to go to that I can learn how to tell the difference between the various types of bp's, co-dom/dom/recessive etc etc etc..........

Any help would be much appreciated!

Thank you

Quote:

---

Originally Posted by rocky88

I have been trying to read up on all the genetics that I can and one of the things that confuses me is that I dont know how to tell the difference between recessive, dominant, and co-dom. I was just curious if anyone knows of any good site to go to that I can learn how to tell the difference between the various types of bp's, co-dom/dom/recessive etc etc etc..........

Any help would be much appreciated!

Thank you

---

http://www.ballpython.ca/genetics.html

Try here. I don't know how to visually see if an animal has a recessive trait, but this website has descriptions about the morphs and it will say recessive, dominant, co-dominant.

http://www.royalvariations.com/index...d=35&Itemid=95

I'll keep looking, I know there is a lot of information out there. I do know a recessive trait will only show up in an animal that is bred to another either with that trait, or het for that trait. For example: Albino X Normal will not give you any visual albinos only het for albinos. They look normal, but can produce albinos.

Quick List off the top of my Head:

RECESSIVE:

Albino
Piebald
Genetic Stripe
Axanthic
Ghost/Hypo
Clown

CO-DOM:

Spider
Pinstripe
Woma
Pastel
Enchi
Sable
Black Pastel
Cinnamon
Mojave
Lesser
Butter
Fire
Het Russo
Vanilla
Yellowbelly

There are plenty more, but that is some of them

I'm not sure what you mean about how to tell the difference between recessive, co-dom, and dominate.

If you just want a list of which morphs are recessive and which ones are co-dom, etc, I am not aware of any place that lists all the morphs. However, here are a few places which list a lot of them:

NERD's site. Lots of beautiful pics. Click on the one that interests you and you'll get even more beautiful pics, plus info on whether the morph is recessive, etc, as well as whether it is a combo and what morphs combine to produce it.
http://www.newenglandreptile.com/ner...ollection.html

Ralph Davis's site. Not so many pics, and sometimes the info hasn't been updated recently (like it may say he hopes to try for a super in 2002 or something). This link is actually the page for albino, but there is a drop down menu in the top right with lots of other base morphs.
http://www.ralphdavisreptiles.com/ma...its/albino.asp

If you are asking about how one figures out whether a new morphs is recessive, co-dom, or dominant, you have to do breeding trials.

To add on to heathers list

Ressesives

Lavender albino
Tristripe
Patternless

No I'm not really looking for a list. I just want to be able to tell which ones are recessive, co-dom etc... All of you experienced bp people, if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc..... How do you know if it is recessive or co-dom, dom? Did you just learn to kinda memorize which are which and now it's just second nature. Or is there some kind of method behind knowing???? Sorry if I am confusing you and you cant figure out what I'm asking. I'm just so confused on the subject:confused::confused:

You find out by breeding. Recessives, doms, and codoms have specific chances of offspring.

Quote:

---

Originally Posted by rocky88

No I'm not really looking for a list. I just want to be able to tell which ones are recessive, co-dom etc... All of you experienced bp people, if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc..... How do you know if it is recessive or co-dom, dom? Did you just learn to kinda memorize which are which and now it's just second nature. Or is there some kind of method behind knowing???? Sorry if I am confusing you and you cant figure out what I'm asking. I'm just so confused on the subject:confused::confused:

---

Yes, you just have to memorize it. After a while, it does become second nature.

Quote:

---

Originally Posted by DutchHerp

You find out by breeding. Recessives, doms, and codoms have specific chances of offspring.

---

Quote:

---

Originally Posted by kc261

Yes, you just have to memorize it. After a while, it does become second nature.

---

I'll echo these statements but go a little further off of what Dutch said.

Recessive, dominant and co-dominant (used incorrectly, but what are you gonna do???) have very specific trend when you breed.

For a recessive trait, the only way you have a visual morph is if you have 2 copies of the mutant gene. Any animals with only one copy of the mutant gene (i.e. hets) are phenotype normal.

For a dominant trait, animals that are homozygous for mutant gene and animals that are heterozygous for mutant gene have the same phenotype.

For a co-dom trait, animals that are heterozygous for the mutant gene have a different phenotype than normals and animals that are homozygous for the mutant have a different phenotype than the heterozygous animals.

It's like back in elementry school with the times tables! The fives are easy, and there are tricks for the nines, but most of them you just have to memorize.

Quote:

---

Originally Posted by rocky88

No I'm not really looking for a list. I just want to be able to tell which ones are recessive, co-dom etc... All of you experienced bp people, if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc..... How do you know if it is recessive or co-dom, dom? Did you just learn to kinda memorize which are which and now it's just second nature. Or is there some kind of method behind knowing???? Sorry if I am confusing you and you cant figure out what I'm asking. I'm just so confused on the subject:confused::confused:

---

Yes, you just start to learn it over time. Your list above:

recessive, dominant, recessive, recessive, recessive, co-dominant, dominant

It's just spending lots of times on breeder's websites, getting books, going to Ralph's and NERD's sites which will tell you if a morph is recessive, dominate, co-dom.

It does become second nature.

another great recource,is SBP's site,which in his forums,he has photos and genetics of pretty much all the morphs,who created them,and genetics behind them,including combos

Quote:

---

Originally Posted by rocky88

if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc.....

---

Quote:

---

Originally Posted by rabernet

Your list above:
recessive, dominant, recessive, recessive, recessive, co-dominant, dominant

---

Robin, if I am interpreting your answer correctly, you are stating that normal is dominant. This is not true.

There are 2 things one needs to understand. First of all, clown, spider, and all the rest of the base morphs (not normal), refer to a single mutated gene. It may or may not require a pair to be visual, but it is just 2 copies of the same gene. Combos are obviously a different story, because they require more than one mutated gene. What many people do not realize is that normal is also a very different story. "Normal" actually refers to quite a few different genes, one normal gene on the clown locus, one different normal gene on the spider locus, yet another different gene on the albino locus, etc.

Also, one should understand that genes are only dominant or recessive in relationship to other genes. I am not aware of any genes that work this way in BPs, but in corns, amelanistic is recessive compared to the normal gene on that locus. There is another gene, ultra, that is on the same locus. Ultra is also recessive compared to normal. However, amel and ultra are co-dominant to each other, and if you have a snake that has one of each, you get an ultramel. Most people will still say that amel (or ultra) is recessive, but that is not true in relationship to each other. In fact, it is impossible for them both to be recessive to each other.

So, getting back to normal in BPs, whether normal is recessive, dominant, or co-dom depends on which normal gene you are referring to, and which mutated gene you are comparing it to. The normal gene on the clown locus is dominant to clown, but the normal gene on the spider locus is recessive to spider, and the normal gene on the pastel locus is co-dominant to pastel.

Quote:

---

Originally Posted by RebelYell83

another great recource,is SBP's site,which in his forums,he has photos and genetics of pretty much all the morphs,who created them,and genetics behind them,including combos

---

Can you provide a link?

Quote:

---

Originally Posted by kc261

Also, one should understand that genes are only dominant or recessive in relationship to other genes. I am not aware of any genes that work this way in BPs, but in corns, amelanistic is recessive compared to the normal gene on that locus. There is another gene, ultra, that is on the same locus. Ultra is also recessive compared to normal. However, amel and ultra are co-dominant to each other, and if you have a snake that has one of each, you get an ultramel. Most people will still say that amel (or ultra) is recessive, but that is not true in relationship to each other. In fact, it is impossible for them both to be recessive to each other.

---

Actually the ultra and the amel are recessive because convention is the relationship of the mutant to the wild type (i.e. normal). Ultra and amel are recessive to the WT whether in homozygous or heterozygous pair. In terms of relationship to one another, ultra and amel are simply alternate alleles (which are indeed co-expressive). The closest example of this in BPs would be the BluEL complex or YB/Whirwind or Cinny/Black Pastel. In each of these the mutants are inc-dom to WT but allelic to the others within the group (i.e. Butter is allelic to Lesser is allelic to Mojave is allelic to Phantom is allelic to Russo.)

Quote:

---

So, getting back to normal in BPs, whether normal is recessive, dominant, or co-dom depends on which normal gene you are referring to, and which mutated gene you are comparing it to. The normal gene on the clown locus is dominant to clown, but the normal gene on the spider locus is recessive to spider, and the normal gene on the pastel locus is co-dominant to pastel.

---

Wild type is neither recessive nor dominant nor co-dom. It is just a baseline by which mutations are measured against.

Quote:

---

Originally Posted by asplundii

Actually the ultra and the amel are recessive because convention is the relationship of the mutant to the wild type (i.e. normal). Ultra and amel are recessive to the WT whether in homozygous or heterozygous pair. In terms of relationship to one another, ultra and amel are simply alternate alleles (which are indeed co-expressive). The closest example of this in BPs would be the BluEL complex or YB/Whirwind or Cinny/Black Pastel. In each of these the mutants are inc-dom to WT but allelic to the others within the group (i.e. Butter is allelic to Lesser is allelic to Mojave is allelic to Phantom is allelic to Russo.)



Wild type is neither recessive nor dominant nor co-dom. It is just a baseline by which mutations are measured against.

---

Hmmm. That is different than what I was taught in college. At least it is different than how I remember it; it was quite a few years ago. :oops:

Do you happen to have any sources where I could study it and make sure I understand it properly?

Quote:

---

Originally Posted by kc261

Hmmm. That is different than what I was taught in college. At least it is different than how I remember it; it was quite a few years ago. :oops:

---

I would be more inclined to think it is more down to your Prof not being able to make the explanation clear. It is kind of a slippery thing to describe.

Think of it this way; You are in the bottom of a well. Are you above or below?

Most people just say you are "below" because they assume a default state where ground level is the baseline/reference point. The correct answer, however, is that the question as asked, without a reference point given, can not be answered. "Below" would be correct if you are using ground level as a reference but if you are using the center of the earth as a reference then you would be "above". Make sense?

So it is with genetic relation. WT is the reference by which we judge whether a mutation is recessive, dominant or co-dom.

Let us look at Pinstripe as an example. When an animal is carrying the mutant gene (be they heterozygous or homozygous for the condition) it appears different than the WT and it only takes one copy of the gene to bring this phenotype about. So Pin is dominant to WT. We do not say that WT is recessive to Pin because Pin is not the normal state of these animals. That is usually the point that catches people. It is true that the WT allele is recessive to the Pin allele but it is the WT allele that is the reference point by which we are judging the animal, not the mutant allele.

Quote:

---

Do you happen to have any sources where I could study it and make sure I understand it properly?

---

Not off hand, just going off my old texts and classes and my day to day work. If you want I can dig up a specific text.

[QUOTE=asplundii;1043204]
Think of it this way; You are in the bottom of a well. Are you above or below?

Most people just say you are "below" because they assume a default state where ground level is the baseline/reference point. The correct answer, however, is that the question as asked, without a reference point given, can not be answered. "Below" would be correct if you are using ground level as a reference but if you are using the center of the earth as a reference then you would be "above". Make sense?
[/I can QUOTE]
Why would you use the center of the Earth as a reference point? It is impossible to be below the center of the Earth when you consider gravitational pull and that apart from gravity, there is no up, above, below, or under.
The reference points (in relation to above or under), would be typical ground level, sea level, or the floor of the well as a modified ground level. Could it then be in relation to the level of the water?
Haha, this is quite off the original topic.
-Steven
-Steven

Quote:

---

Originally Posted by asplundii

actagggcagtgatatcccattggtacatggcaaattagcctcatgat

---

OK, I did a BLASTn and this sequence is fairly homologous to several genes in any number of creatures from humans to zebrafish to rice and a fair number of beasties in between. And asplundii is the species name for several different botanical forms. So spill, 'cause it's driving me crazy. What's the sequence?

Quote:

---

Originally Posted by stevenkeogh

Why would you use the center of the Earth as a reference point? It is impossible to be below the center of the Earth when you consider gravitational pull and that apart from gravity, there is no up, above, below, or under

---

Well I was just using hyperbole to make a point :P But yes you are correct, there can be no "below" the center of the earth LOL

Quote:

---

The reference points (in relation to above or under), would be typical ground level, sea level, or the floor of the well as a modified ground level. Could it then be in relation to the level of the water?

---

The reference point can be anything you want it to be actually. I could use the crust/mantle boundary or the mantle/outer core boundary if I wanted. Or I could use an ambiguous spot exactly 6" below the well. The point I was trying to make is that you need a specific point of reference before you can say definitively that you are "above" or "below".

Quote:

---

Haha, this is quite off the original topic.

---

My apologies to the OP. I'll shut up now (or as soon as I answer GenePirate)

Quote:

---

Originally Posted by GenePirate

OK, I did a BLASTn and this sequence is fairly homologous to several genes in any number of creatures from humans to zebrafish to rice and a fair number of beasties in between. And asplundii is the species name for several different botanical forms. So spill, 'cause it's driving me crazy. What's the sequence?

---

Well my handle and the sequence have nothing in common. I use asplundii after Utricularia asplundii which is one of many plants I grow.

BLAST won't give you the answer to the sequence either I am afraid because it is not specific to any given organism.

I'll PM you to keep you from going nuts :D