Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 631

0 members and 631 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 10 of 21

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Health Defects in Albinos?

    Quote Originally Posted by neilgolli View Post
    zhang, Your friend needs some hands on experience with animals and not a left slanted "schooling" on natural evolution and genetics.
    Neil,

    I mean no disrespect but there is nothing wrong with the teaching of natural selection and genetics and there is nothing that is particularly "left" about either. I believe in this case the problem is that the friend probably only has the very rough base of evolution as taught in a couple days during a basic biology course. One of those situations where you know just enough to make yourself think you know all you need to know. If you have a deeper understanding of genetics (like, say, as a profession) and have taken 7 or 8 college and graduate level courses on the finer points of evolution then you come to a greater understanding of the process that allows you understand why statements of "albinos are nature's way of culling bad genes... Darwinism says so." are not at all accurate.

    Cheers
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    JeffFlanagan (02-18-2009),Mendel's Balls (07-27-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1