Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,785

0 members and 1,785 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,111
Threads: 249,260
Posts: 2,573,015
Top Poster: JLC (31,651)
Welcome to our newest member, MittieParris8
Results 1 to 10 of 21

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Health Defects in Albinos?

    Your friend is over simplifying, grossly.

    Yes, albinos are less likely to live long lives in the wild cause nothing stands out quite so much as a stark white and yellow snake. But, obviously some do survive cause the gene is in the populations and wild albinos are caught... Albinos do not necessarily have "bad" eyesight but because of the lack of melanin their eyes (and skin) are more sensitive to light, especially UV, and so they are more easily damaged by the light (i.e blinded). In some animals, exposure to sunlight is necessary for proper VitD3/calcium metabolism but nocturnal animals (like balls) tend to have evolved ways of dealing with that. Ditto for the skin, some processes that "toughen" skin are catalized by exposure to sunligh. But we are talking about snakes so that whole scale thing comes in to play so...

    If you want to look at the albino gene as "bad" because of those aspects I guess you can. I do not think of it as such, it is just less "fit" under wild conditions. And it is only the albino gene that is being selected against in the wild, not some amalgam of bad genes inducing the albino gene to occur so that the rest get culled. None of that really matters though when you are talking about a captive kept snake (or any animal for that matter.) In the wild, yeah, an albino animal is likely to be selected against, but in captivity there is no selective pressure againt the albino gene and an albino animal is no more or less likely to be carrying "bad" genes than any other morph.

    And, if you really want to argue with your friend, then tell him that, according to his logic of animals with bad genes ought not be kept as pets, he ought to never own a dog because every breed has some type of genetic based disease/diseases that tend to be specific to the breed because of the inbreeding done to select for the traits of the breed.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Mendel's Balls (07-27-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1