» Site Navigation
0 members and 1,770 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,111
Threads: 249,260
Posts: 2,573,015
Top Poster: JLC (31,651)
|
-
Registered User
Health Defects in Albinos?
I was told by a Zoology graduate from the University of British Columbia that albinism was nature's way of eliminating bad genes.
He said when two carriers of weak genes reproduce, the offsprings has a higher chance of having albinism. In the wild, an animal's appearance in terms of color and shade is a major defense system. Albinos, due to their unusual appearance, are more likely to be exposed, and therefore more variable to danger. Also, he said albinism causes direct health defects, such that animals including humans who have albinism, have poorer eyesight, more fragile skin, and a weak bone structure due to their inability to receive the proper nutrients from the sun. In the end he told me this was according to Darwinism, and that it was cruel to keep an albino snake.
I, as a major fan of Ball Python morphs, had a extremely hard time listening to this. I kept thinking about it, and debated whether or not to post this, as I know this is very undesirable thing to hear. It seems that his theory has some logic to it. I do not have any direct personal experience with Ball Python morphs but was hoping those who do could share some of their experience. Do albinos, or other morphs, act different in terms of health or behavior in comparison with normals? If so, are the health defects so significant that it is cruel to keep one? I really hope that his theory is not true, because I really want to own a piedbald some day.
1.0 Pastel Piebald - Francis
-
-
BPnet Veteran
Re: Health Defects in Albinos?
While I do personally think that a bright white and yellow snake would be easier to find in the wild versus a normal, I doubt it's nature's way of picking out a snake with weak genes o.O In my opinion, it's just another morph, just another set of genes, just like blond hair and blue eyes are recessive traits, which is why most people have dark hair and dark eyes, because these traits are dominant. There are however those BP morphs that do have defects associated with their specific genetics, like the Spider wobble, or the Caramel kinks, etc. In my opinion these are just defects that come along with the different genetics, and albinism isn't some way to get rid of these animals with weak genes. It's like, midgets (no offense intended to anyone of course), or being white, or black, or asian. It's genetics. If you mix an albino with a spider and get an albino spider, you're not ensuring this animals death and being cruel because all spiders have some sort of wobble, and albinos 'have weak genes.' Just like me being phillipino-german-polish doesn't make me a broken toothed nazi jew!
Last edited by Lateralus_Love; 02-18-2009 at 03:21 AM.
Ball Pythons:
1.0 Queenbee; 1.0 Spider; 1.0 Spider Het VPI Axanthic
1.0 Albino Cinny; 1.0 Albino Pin; 1.0 Butter Pastel
0.1 Het Axanthic; 0.2 Albino; 0.1 Pied
0.1 Pastave; 0.1 Pastel; 0.1 Butter
0.1 Super Vanilla Mojave
Others:
1.0 Kahl Albino BCI
1.0 Albino Anaconda Hognose
Mammals:
4.0 Kitties, 3.1 Doggos, 0.2 Horses
-
-
Re: Health Defects in Albinos?
He's entitled to his opinion, but I'd hazard that the many lines of albino and the many generations of albino, all thriving in the care of keepers all over, mean that Albino BPs are not defective(except in coloration, which is a minor mutation).
I consider it more like a birth mark on someone. BPs do not need to bask, and therefor the albino doesn't affect them. I never noticed my albino keeping away from light, or hiding overmuch. Never heard of any issues related to albinos.
I think he's full of bunk, and just thinks anything odd is a "mutant" and therefor "defective". Let him have his opinion, he's entitled to it, however wrong it might be.
Theresa Baker
No Legs and More
Florida, USA
"Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "
-
-
Re: Health Defects in Albinos?
Your friend is over simplifying, grossly.
Yes, albinos are less likely to live long lives in the wild cause nothing stands out quite so much as a stark white and yellow snake. But, obviously some do survive cause the gene is in the populations and wild albinos are caught... Albinos do not necessarily have "bad" eyesight but because of the lack of melanin their eyes (and skin) are more sensitive to light, especially UV, and so they are more easily damaged by the light (i.e blinded). In some animals, exposure to sunlight is necessary for proper VitD3/calcium metabolism but nocturnal animals (like balls) tend to have evolved ways of dealing with that. Ditto for the skin, some processes that "toughen" skin are catalized by exposure to sunligh. But we are talking about snakes so that whole scale thing comes in to play so...
If you want to look at the albino gene as "bad" because of those aspects I guess you can. I do not think of it as such, it is just less "fit" under wild conditions. And it is only the albino gene that is being selected against in the wild, not some amalgam of bad genes inducing the albino gene to occur so that the rest get culled. None of that really matters though when you are talking about a captive kept snake (or any animal for that matter.) In the wild, yeah, an albino animal is likely to be selected against, but in captivity there is no selective pressure againt the albino gene and an albino animal is no more or less likely to be carrying "bad" genes than any other morph.
And, if you really want to argue with your friend, then tell him that, according to his logic of animals with bad genes ought not be kept as pets, he ought to never own a dog because every breed has some type of genetic based disease/diseases that tend to be specific to the breed because of the inbreeding done to select for the traits of the breed.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: Health Defects in Albinos?
 Originally Posted by asplundii
And, if you really want to argue with your friend, then tell him that, according to his logic of animals with bad genes ought not be kept as pets, he ought to never own a dog because every breed has some type of genetic based disease/diseases that tend to be specific to the breed because of the inbreeding done to select for the traits of the breed.
Your right, I need to go shoot my dogs and put all my morphs in the freezer and join PETA today.......
zhang, Your friend needs some hands on experience with animals and not a left slanted "schooling" on natural evolution and genetics. An albino ball is the exact same animal, with the same needs and care requirements of a normal ball python just with a different paint job. While most are weeded out by predation in the wild, don't be fooled into thinking that adult morphs don't exist in the African bush. Some mutations hinder while others assist in daily lives.
I'm off now, be back later.
ps, go out and buy that pied, its good for the economy
Last edited by Stewart_Reptiles; 02-18-2009 at 02:18 PM.
Reason: Making post family friendly again ;)
Support my efforts to raise awareness and donations to the Alzheimer's Association in honor of my Grandfather Eugene......
www.awalktoendalzheimers.com
"No man's life, liberty or fortune is safe while our legislature is in session." - Benjamin Franklin
-
The Following User Says Thank You to neilgolli For This Useful Post:
-
BPnet Veteran
Re: Health Defects in Albinos?
In a pet, certain traits that would be undesirable in the wild, are actually sought after.
Nature fine tunes things for survival of the fittest. As soon as man starts playing around with the gene pool,to make something "cute" or "interesting" you can bet it's not going to be as good as the original.
Still a pet is exactly that, a pet. Protected and cared for by their loving owners.
My albinos seem happy... they eat,breed, ect. The fact that they would not do well in the wild means little to me.
-
-
Re: Health Defects in Albinos?
 Originally Posted by neilgolli
zhang, Your friend needs some hands on experience with animals and not a left slanted "schooling" on natural evolution and genetics.
Neil,
I mean no disrespect but there is nothing wrong with the teaching of natural selection and genetics and there is nothing that is particularly "left" about either. I believe in this case the problem is that the friend probably only has the very rough base of evolution as taught in a couple days during a basic biology course. One of those situations where you know just enough to make yourself think you know all you need to know. If you have a deeper understanding of genetics (like, say, as a profession) and have taken 7 or 8 college and graduate level courses on the finer points of evolution then you come to a greater understanding of the process that allows you understand why statements of "albinos are nature's way of culling bad genes... Darwinism says so." are not at all accurate.
Cheers
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
JeffFlanagan (02-18-2009),Mendel's Balls (07-27-2009)
-
Re: Health Defects in Albinos?
Albinos exist in plenty of species that live successfully in the wild. Native Americans in the past often revered white buffalo, bear and deer that lived to ripe old ages. Albino examples of animals that are legally hunted are generally protected by law. These laws are passed at the urging of other wildlife biology experts that don't agree with the man that you are quoting. An albino is certainly hyper sensitive to sunlight and if a reptile that needed to bask in direct sunlight was born as an albino it would certainly have a genetic problem and would not survive. But many animals in the wild are nocturnal and such animals have no problem surviving. I'm just an old uneducated guy and even I can see that to say that because a gene is recessive it is evidence of passing on an undesirable trait is foolish idea.
-
-
Registered User
Re: Health Defects in Albinos?
I agree, I don't think the friend is "stupid" or anything, he's just flat-out wrong. I hope he extrapolated this idea from lecture material, and that this was not something a teacher told him.
I don't think you can really call a gene "weak." Yes, some traits make organisms less likely to thrive, but the genes in and of themselves are not weak, and certainly the animal's genome is not going to change and make it albino just because it has some deleterious alleles at important genes that govern its success at survival and reproduction. If this were the case, the cats at our shelters with neurological disorders would be albino, as would humans with DS, or even severe autism.
Natural selection cannot act on the genes themselves, only on the phenotype of the individual animal once it's out in the world. Your friend is suggesting that somehow animals are being selected against and "targeted" for consumption by predators before they are even born, and this is simply just not so.
v
-
-
BPnet Veteran
Re: Health Defects in Albinos?
 Originally Posted by Vacado
Natural selection cannot act on the genes themselves, only on the phenotype of the individual animal once it's out in the world. Your friend is suggesting that somehow animals are being selected against and "targeted" for consumption by predators before they are even born, and this is simply just not so.
v
It could also select based on the behavioral / physical results of that gene too. Take Chrone's disease, poor eyesight, etc... for example.
JonV
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|