» Site Navigation
1 members and 792 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,120
Top Poster: JLC (31,651)
|
-
Re: opinion on sibling breedings
The statements about sib x sib = parent x offspring are true as far as the odds, but I believe that it really ends up being random. It depends on where the bad genes are (if there are any), and we don't know that in advance.
If you have a male snake that has some genetics you want to work with, you could breed him to his daughters. If he also happens to have some bad genes, that could end up being a bad situation, and breeding his sons to his daughters (brother to sister) would be better. But, on the flip side, maybe the dad is fine genetically, but the normal female you bred him with carried a bad gene, then breeding back to the father would be safe, but the brother to sister might result in deformed offspring.
The safest thing might be to breed the male to at least 2 different females, then bred half-siblings to each other. However, that still doesn't guarantee that you won't end up with a defect popping up.
It does seem that doing a moderate amount of line breeding or inbreeding usually does not turn up any issues. I've seen a lot of people say it appears to be safer with reptiles, but in actuality I know a lot of line breeding and inbreeding has been done with dog breeds and lots of other domesticated animals, and while genetic defects do turn up sometimes, it is relatively rare in comparison to the amount of inbreeding that gets done. So I'm not sure about "safer" with reptiles, but it certainly appears safe enough when done in moderation.
-
-
Re: opinion on sibling breedings
 Originally Posted by kc261
The statements about sib x sib = parent x offspring are true as far as the odds, but I believe that it really ends up being random.
Well yes and no. The way gametes are generated with the segregation of the chromosomes and crossing over events and such does randomize it some. But by and large the odds that siblings share 50% of their genes is greater than them sharing 75% of their genes or 25% of their genes. Especially when you consider (like JonV noted) the huge amount of material you are dealing with.
Since we can not necessarily know the exact genetic make up of each sib in a sib x sib breeding I think it is wiser to head the odds that they are 50% common rather than try to beat the odds that they are not.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: opinion on sibling breedings
 Originally Posted by asplundii
Any given offspring shares 50% of its parents genes.
Any two siblings share 50% of their genes.
So parent x offspring = sib x sib
This is not exactly correct. Lets do the math. Lets say you have 2 snakes with 2 alleles each allele having 2 genes and you breed them together and get 2 offspring.
Dad has 4 genes in 2 pairs. AB and CD Mom has 4 genes in 2 pairs EF and GH.
So your combos for offspring are
AE and CG
AE and CH
AE and DG
AE and DH
AF and CG
AF and CH
AF and DG
AF and DH
BE and CG
BE and CH
BE and DG
BE and DH
BF and CG
BF and CH
BF and DG
BF and DH
Ok so the point is that its possible to get two siblings that have no genes in common. (AE and CG) and (BF and DH) for instance.
So parent x offspring = 50% shared genes
and sib x sib ≈ 50% shared genes
For those of you not math nerds the wavy equal sign means approximately.
Statistically siblings share 50% of their genes when looked at in total. They can and will have alleles that are identical and some that are completely different. With a parent x offspring pairing you get 50% shared per allele and thus 50% total.
-
-
Re: opinion on sibling breedings
 Originally Posted by Egapal
This is not exactly correct.
So parent x offspring = 50% shared genes
and sib x sib ≈ 50% shared genes
For those of you not math nerds the wavy equal sign means approximately.
Statistically siblings share 50% of their genes when looked at in total.
Yes and I said as much in my follow up post above yours. And I made the point that if I were going to be making bets I'd be more likely to bet the 50% odds than the 75% or 25% odds.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: opinion on sibling breedings
I think the question we need to answer is to run the offspring back through a parent and run two offspring together, and average this over all possible cases for the 16 offspring to get a conclusive average.
The parent, offspring is easy: This new offspring will be allozygous for 50% of its genes.
Anyone wanna do 16 x 16 for the sib-sib? 
JonV
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|