Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,317

1 members and 1,316 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,934
Threads: 249,129
Posts: 2,572,283
Top Poster: JLC (31,651)
Welcome to our newest member, LavadaCanc
Page 1 of 2 12 LastLast
Results 1 to 10 of 15
  1. #1
    BPnet Veteran Kryptonian's Avatar
    Join Date
    07-02-2008
    Location
    edmonton alberta canada
    Posts
    634
    Thanks
    6
    Thanked 83 Times in 69 Posts
    Images: 2

    opinion on sibling breedings

    I am interested on hearing how people view the breeding of a brother to a sister in snakes to get the morph you want. I am firmiliar with line breeing where you breed the offspring to the parent and that its common in many species especially livestock. Since the offspring only shares half of the parents genes there is enough that there isnt too many shared that you end up with deformities like you might if you inbreed. I have even line bred hamsters when I used to breed them to get the color I wanted to sell that breeders were not giving up the female of that color. It was a reccesive color so I line bred a female to her father to create my own female of that color. So in snakes are you not at the same risk of deformities when breeding siblings?
    Eg, if I were to buy a male albino and a female axanthic and breed them the offspring would all be double hets. If you bred the offsping together there is a chance at snows, but is that safe to do? Any breeders that can share thier experience please do, thanks.
    1.0 50% het clown 1.0 50% het lavender 2.6 normal bp 1.0 normal poss axanthic 1.0 het pied bp 1.0 yellow belly 1.0 mojave bp 2.0 spider bp 2.1 pastel bp1.1 Cinnamon bp
    7.0 corns - normal motley stripe het snow,anery a het hypo, snow, red candy cane, motley stripe orange candy cane, anery motley possible ghost , butter motley 0.6 corns -amel,high white amel,creamsicle,ghost, snow, orange candy cane 1.0 albino jungle corn, 1.0 mexican black king, 1.0 california king, 1.0 milk snake 0.1 kenyan sand boa 0.1 dummerils boa 1.1 bci normal, 0.1 pastel bci,0.1 kahl albino bci,1.0 salmon het kahl albino bci, 0.1 guatamalan boa 0.1 hogg island boa 1.0 JCP 0.1 woma python 3.0 leos-normal,blizzard,rw albino,rw b blizzard 0.7 leos-normal,hypo tangerine,mack snow,albino, rwb blizzard,raptor, rw albino 0.1 C. Turneri (thick toed gecko)1.1 crested gecko0.1rose hair T. 0.0.1 black emporer scorpion
    1.0 beardie

    http://kryptonianreptiles.webs.com Kryptonian Reptiles now on Facebook

  2. #2
    BPnet Veteran Oxylepy's Avatar
    Join Date
    10-25-2008
    Location
    Pittsburgh Pennsylvania
    Posts
    2,383
    Thanks
    362
    Thanked 573 Times in 434 Posts

    Re: opinion on sibling breedings

    From what I have learned people do it all the time and there really isn't any problem with it. But if you keep inbreeding them like that after a time there is a much higher chance of a genetic deformity presenting itself. But doing it with one generation? Sure people do it all the time.
    Ball Pythons 1.1 Lesser, Pastel
    1.0 Lesser Pastel, 0.0.7 mixed babies

  3. #3
    BPnet Veteran Toronto Python Gurus's Avatar
    Join Date
    01-05-2009
    Location
    Toronto, Ontario, Canada
    Posts
    443
    Thanks
    187
    Thanked 78 Times in 65 Posts

    Re: opinion on sibling breedings

    to prove a snake you pretty much have to breed siblings, NERD spent years tryin to prove out the spider gene, alot of people say thats why spiders have the head wobble, but every morph that has been produced or proved out came from the same bloodline, there is only one spider line out there which came from the original NERD spiders
    Cheers!
    Mike,
    Toronto Python Gurus.webs.com
    BBM PIN: 21D7758C

  4. #4
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Blog Entries
    2
    Images: 46

    Re: opinion on sibling breedings

    Quote Originally Posted by Python Guru View Post
    to prove a snake you pretty much have to breed siblings, NERD spent years tryin to prove out the spider gene, alot of people say thats why spiders have the head wobble, but every morph that has been produced or proved out came from the same bloodline, there is only one spider line out there which came from the original NERD spiders
    The original spider had the head wobble - and spiders are some of the most outcrossed ball pythons, since they've proved to be dominant. I don't believe that inbreeding has anything to do with the spider wobble, FWIW.

  5. The Following User Says Thank You to rabernet For This Useful Post:

    Wh00h0069 (02-10-2009)

  6. #5
    BPnet Veteran nevohraalnavnoj's Avatar
    Join Date
    09-04-2007
    Location
    Norfolk, Virginia
    Posts
    1,098
    Thanks
    57
    Thanked 102 Times in 69 Posts
    Images: 1

    Re: opinion on sibling breedings

    I recall some readings I did a while back that stated offspring-parent was in fact a much worse breeding than sib-sib. It was approximately: the offspring from offspring-parent would have identical gene copies for 50% of the genes, and sib-sib would be something like 37.5%.

    I tried to dig up that page and couldn't find it.

    Then I tried to do my own punnet square experiment to determine how many identical gene pairs offspring under the two breedings would have, and I keep arriving at sib-sib has more identical gene pairs.

    Can anyone resolve this?

    JonV

  7. #6
    BPnet Veteran littleindiangirl's Avatar
    Join Date
    03-31-2007
    Posts
    8,193
    Thanks
    637
    Thanked 794 Times in 487 Posts
    Images: 25

    Re: opinion on sibling breedings

    I believe sib - sib is worse than parent to offspring. Because each offspring will have the genetic make up from both parents, whereas, the parent will always have genetics that the offspring did not get.

    I do believe with reptiles it is easier to get away with inbreeding or line breeding for a couple of generations.

  8. #7
    BPnet Veteran Kryptonian's Avatar
    Join Date
    07-02-2008
    Location
    edmonton alberta canada
    Posts
    634
    Thanks
    6
    Thanked 83 Times in 69 Posts
    Images: 2

    Re: opinion on sibling breedings

    Quote Originally Posted by nevohraalnavnoj View Post
    It was approximately: the offspring from offspring-parent would have identical gene copies for 50% of the genes, and sib-sib would be something like 37.5%.
    Wouldnt that be best case scenario? I think it would be possible that sibs could share 100% of the same genes depending on which ones they inherit from the parents.Twins for example.
    1.0 50% het clown 1.0 50% het lavender 2.6 normal bp 1.0 normal poss axanthic 1.0 het pied bp 1.0 yellow belly 1.0 mojave bp 2.0 spider bp 2.1 pastel bp1.1 Cinnamon bp
    7.0 corns - normal motley stripe het snow,anery a het hypo, snow, red candy cane, motley stripe orange candy cane, anery motley possible ghost , butter motley 0.6 corns -amel,high white amel,creamsicle,ghost, snow, orange candy cane 1.0 albino jungle corn, 1.0 mexican black king, 1.0 california king, 1.0 milk snake 0.1 kenyan sand boa 0.1 dummerils boa 1.1 bci normal, 0.1 pastel bci,0.1 kahl albino bci,1.0 salmon het kahl albino bci, 0.1 guatamalan boa 0.1 hogg island boa 1.0 JCP 0.1 woma python 3.0 leos-normal,blizzard,rw albino,rw b blizzard 0.7 leos-normal,hypo tangerine,mack snow,albino, rwb blizzard,raptor, rw albino 0.1 C. Turneri (thick toed gecko)1.1 crested gecko0.1rose hair T. 0.0.1 black emporer scorpion
    1.0 beardie

    http://kryptonianreptiles.webs.com Kryptonian Reptiles now on Facebook

  9. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: opinion on sibling breedings

    Any given offspring shares 50% of its parents genes.

    Any two siblings share 50% of their genes.

    So parent x offspring = sib x sib
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #9
    BPnet Veteran nevohraalnavnoj's Avatar
    Join Date
    09-04-2007
    Location
    Norfolk, Virginia
    Posts
    1,098
    Thanks
    57
    Thanked 102 Times in 69 Posts
    Images: 1

    Re: opinion on sibling breedings

    Quote Originally Posted by asplundii View Post
    Any given offspring shares 50% of its parents genes.

    Any two siblings share 50% of their genes.

    So parent x offspring = sib x sib

    It is the "rule of halves"
    This is exactly what I was getting in my calculation as well....

    JonV

  11. #10
    BPnet Veteran nevohraalnavnoj's Avatar
    Join Date
    09-04-2007
    Location
    Norfolk, Virginia
    Posts
    1,098
    Thanks
    57
    Thanked 102 Times in 69 Posts
    Images: 1

    Re: opinion on sibling breedings

    Quote Originally Posted by Kryptonian View Post
    Wouldnt that be best case scenario? I think it would be possible that sibs could share 100% of the same genes depending on which ones they inherit from the parents.Twins for example.
    Sibs could, theoretically, share 100% of the same genes but statistically speaking (which makes sense since we are on the order of millions/billions of DNA base pairs) each sib shares 50% of its genes with other sibs.

    Twins are indeed a counterexample.

    JonV

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1