Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 627

1 members and 626 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,117
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 15

Hybrid View

  1. #1
    BPnet Veteran Egapal's Avatar
    Join Date
    09-28-2008
    Location
    Upstate New York
    Posts
    689
    Thanks
    59
    Thanked 213 Times in 138 Posts
    Images: 8

    Re: opinion on sibling breedings

    Quote Originally Posted by asplundii View Post
    Any given offspring shares 50% of its parents genes.

    Any two siblings share 50% of their genes.

    So parent x offspring = sib x sib
    This is not exactly correct. Lets do the math. Lets say you have 2 snakes with 2 alleles each allele having 2 genes and you breed them together and get 2 offspring.

    Dad has 4 genes in 2 pairs. AB and CD Mom has 4 genes in 2 pairs EF and GH.

    So your combos for offspring are
    AE and CG
    AE and CH
    AE and DG
    AE and DH
    AF and CG
    AF and CH
    AF and DG
    AF and DH
    BE and CG
    BE and CH
    BE and DG
    BE and DH
    BF and CG
    BF and CH
    BF and DG
    BF and DH

    Ok so the point is that its possible to get two siblings that have no genes in common. (AE and CG) and (BF and DH) for instance.

    So parent x offspring = 50% shared genes
    and sib x sib ≈ 50% shared genes

    For those of you not math nerds the wavy equal sign means approximately.
    Statistically siblings share 50% of their genes when looked at in total. They can and will have alleles that are identical and some that are completely different. With a parent x offspring pairing you get 50% shared per allele and thus 50% total.

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: opinion on sibling breedings

    Quote Originally Posted by Egapal View Post
    This is not exactly correct.
    So parent x offspring = 50% shared genes
    and sib x sib ≈ 50% shared genes

    For those of you not math nerds the wavy equal sign means approximately.
    Statistically siblings share 50% of their genes when looked at in total.
    Yes and I said as much in my follow up post above yours. And I made the point that if I were going to be making bets I'd be more likely to bet the 50% odds than the 75% or 25% odds.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    BPnet Veteran nevohraalnavnoj's Avatar
    Join Date
    09-04-2007
    Location
    Norfolk, Virginia
    Posts
    1,098
    Thanks
    57
    Thanked 102 Times in 69 Posts
    Images: 1

    Re: opinion on sibling breedings

    I think the question we need to answer is to run the offspring back through a parent and run two offspring together, and average this over all possible cases for the 16 offspring to get a conclusive average.

    The parent, offspring is easy: This new offspring will be allozygous for 50% of its genes.

    Anyone wanna do 16 x 16 for the sib-sib?

    JonV

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1