» Site Navigation
1 members and 709 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,908
Threads: 249,107
Posts: 2,572,126
Top Poster: JLC (31,651)
|
-
Re: woma lessers
I don't believe that there was only one woma to ever come out of africa. Ball python breeding has been around for decades, and who is to say that they didn't find another WC african woma? How would you know that a normal looking woma wouldn't carry the hidden gene, unless you proved it out by breeding it to a lesser?
I never said that there was only one woma to come out of Africa. I said it was possible that only one woma with the hidden gene could have come out of Africa.
I'm quite sure when the Soul Sucker was first produced that most people who had woma's and lessers in their collections have tried and failed to re-produce it. Why has no one else produced it? Hidden gene woma.
Along w/ that, how would kevin have known that a woma x lesser made a soul sucker? In his earlier days he could have been trying to produce something else w/ a woma, and instead sold the "hidden gene" womas by accident as normal looking womas.
Well of course he wouldn't know it would make a soul sucker until he produced it. Just like he didn't know he'd make an inferno until he put three genes together. Until the first one is produced, you won't know what you're going to get.
Kevin has told me that hidden gene womas have markers that set them apart from "normal" woma's. That's how he knew it was different. Kevin is a professional with years of experience and an eye to be able to tell when an animal is special or different from the norm.
I think the "hidden gene" theory is just BS. I think to make a soul sucker it is a combination of genes, like a triple co-dom, rather than 2 co-doms + hidden gene.
You are entitled to your opinion. However, knowing Kevin and Kara as I do as friends, I will choose to believe what they tell me is true. And I'm so willing to believe it, that I'm also going to be willing to pay MUCH more for a hidden gene woma from Kevin when I'm ready for one, than a "normal" woma.
I know that the hidden gene is not BS, but if you've decided it is, there's not much that can be said to change your mind.
-
-
Re: woma lessers
Alright but the thing I wanna know is:
Is it really a "hidden" gene, aka an entirely different gene than the Woma gene, OR is their Woma gene just a higher end mutation. I suppose the only way to know for sure would be to produce combos and breed them off and take tallies of which offspring show the signs of the hidden gene and which offspring show no signs of the hidden gene.
Also what is all this Soul Sucker 2.0 jazz?
Oh and by making tallies of which show signs of it I mean: If any of the ones that SHOULD show signs of it do not, then it is a different gene, if you can never produce one that doesn't show signs of it then it should be viewed as a higher end version of the Woma gene.
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
Registered User
Re: woma lessers
 Originally Posted by Oxylepy
Alright but the thing I wanna know is:
Is it really a "hidden" gene, aka an entirely different gene than the Woma gene, OR is their Woma gene just a higher end mutation. I suppose the only way to know for sure would be to produce combos and breed them off and take tallies of which offspring show the signs of the hidden gene and which offspring show no signs of the hidden gene.
Also what is all this Soul Sucker 2.0 jazz?
Oh and by making tallies of which show signs of it I mean: If any of the ones that SHOULD show signs of it do not, then it is a different gene, if you can never produce one that doesn't show signs of it then it should be viewed as a higher end version of the Woma gene.
I think you are making some valid points. Its so interesting that people think the "hidden gene" came from the Woma. It DIDNT!! The Woma that sired the Soulsucker was 3nd or 4th generation, produced from a "weird" female.That Female is the Key not the Woma! The woma was first produced by NERD in 1999. THe Soulsucker was made in 2005. The math tells all. And of course, NO ONE has made a soulsucker from lesser to woma. Not Jeremy stone, not BHB, not Snakekeeper, etc. And those are from Woma's that came from Nerd.
-
The Following 2 Users Say Thank You to roadrunner For This Useful Post:
grunt_11b (02-07-2009),joshthaxton (02-07-2009)
-
Registered User
Re: woma lessers
 Originally Posted by roadrunner
I think you are making some valid points. Its so interesting that people think the "hidden gene" came from the Woma. It DIDNT!! The Woma that sired the Soulsucker was 3nd or 4th generation, produced from a "weird" female.That Female is the Key not the Woma! The woma was first produced by NERD in 1999. THe Soulsucker was made in 2005. The math tells all. And of course, NO ONE has made a soulsucker from lesser to woma. Not Jeremy stone, not BHB, not Snakekeeper, etc. And those are from Woma's that came from Nerd.
I couldn't have stated it better myself, thanks
-
-
BPnet Veteran
-
The Following User Says Thank You to Bill Buchman For This Useful Post:
-
Re: woma lessers
Thank you for that background, I was not aware of any of that info. Just going off what Kevin said on Reptile Radio I got the impression they were the same "hidden" gene. What you say would indicate otherwise.
More projects for the genetics mill...
 Originally Posted by jluman
A few more things:
The hidden gene in the woma is not the same as the hidden gene in the platinum. A few years ago NERD was selling lessers that were hidden gene (from the woma/soulsucker) carriers. If the hidden gene from the platinum was involved, the lesser couldn't carry it. With that gene, a snake can be a lesser, or a hidden gene carrier, if both genes are present it would be a visual platinum.
The hidden gene in the woma or platinum lines isn't the same as what makes the crystals. BHB has produced snakes that look very similar to crystal using lessers. Here's a pic, from EBN's site again.
http://www.exoticsbynature.com/daytona06/bhb4.jpg
Also, Tom Baker produced a super of the morph that makes crystals when bred to a mojave. RDR produced I think 40+ eggs from hiden gene carrier to hidden gene carrier breedings and didn't get any visual morphs.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|