Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 680

0 members and 680 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,113
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 2 FirstFirst 12
Results 11 to 18 of 18
  1. #11
    BPnet Veteran Lucas339's Avatar
    Join Date
    10-08-2008
    Location
    Fort Pierce
    Posts
    2,104
    Thanks
    158
    Thanked 389 Times in 366 Posts
    Images: 2

    Re: Question!!what small bugs in empty water dish

    Quote Originally Posted by asplundii View Post
    I am more inclined to believe they are spring tails. Rather common in organic/wood mulches and they have a prediliction for congregating around water. Totally harmless.
    i have them in my chondro cage. nothing to worry about.....but a picture is a must for us to be able to tell the difference. what color are they??

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Question!!what small bugs in empty water dish

    Quote Originally Posted by Texas Dan View Post
    You're going to say this and you don't know what he's talking about? I don't see a picture here,maybe because i'm at work. But saying "it's totally harmless" is the wrong way to go.

    At least get a can of PAM, it can't hurt. (unless you use it wrong) And will probably kill whatever it is.
    I hate to sound like an twit but you do not know what he is talking about either so kindly do not get all high and mighty on me.

    With no picture, no I can not say for certain that it is spring tails but neither can you say it is mites. You said it was likely mites and that he should get the PAM. Fine, you are entitled to your opinion (and it is just that cause there is no pic so you really do not know what it is he is talking about.) I said it was likely spring tails which are harmless and if it is indeed spring tails then yes, I bloody well can say they are harmless. They are not parasitic, they do not carry animal borne pathogens... So, plain and simple spring tails are totally harmless. And, as you are entitled to your opinion so too am I entitled to mine (and it is just that cause there is no pic so I really do not know what it is he is talking about either.)

    Quote Originally Posted by Lucas339 View Post
    i have them in my chondro cage. nothing to worry about
    Ditto. And my GBK cage and all my ball cages and my egg eater cages and my carpet cage and my Dendro tank and my Phyllomedusa tank. Springs eat detritus, nothing to worry about at all.

    .....but a picture is a must for us to be able to tell the difference. what color are they??
    Yes, I agree. A pic would help significantly. Behavior is a good indicator too cause springs and mites behave very different. Namely, springs will "spring" away if you bring your finger near them.
    Last edited by asplundii; 01-16-2009 at 01:17 PM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #13
    BPnet Veteran Texas Dan's Avatar
    Join Date
    02-19-2008
    Location
    Dallas, TX
    Posts
    836
    Thanks
    12
    Thanked 24 Times in 16 Posts
    Images: 2

    Re: Question!!what small bugs in empty water dish

    Quote Originally Posted by asplundii View Post
    I hate to sound like an twit but you do not know what he is talking about either so kindly do not get all high and mighty on me.

    With no picture, no I can not say for certain that it is spring tails but neither can you say it is mites. You said it was likely mites and that he should get the PAM. Fine, you are entitled to your opinion (and it is just that cause there is no pic so you really do not know what it is he is talking about.) I said it was likely spring tails which are harmless and if it is indeed spring tails then yes, I bloody well can say they are harmless. They are not parasitic, they do not carry animal borne pathogens... So, plain and simple spring tails are totally harmless. And, as you are entitled to your opinion so too am I entitled to mine (and it is just that cause there is no pic so I really do not know what it is he is talking about either.)
    I'm not trying to argue here with you, not what I wanted to do at all. I'm just saying, prepare for the worst, and if they are harmless, oh well. At least if they get PAM they are doing something active.

    Sorry if I sounded high and mighty, not was I was going for.
    1.0.0 Normal BP: Vincent Vega

  4. #14
    Registered User
    Join Date
    01-15-2009
    Posts
    2
    Thanks
    3
    Thanked 0 Times in 0 Posts

    Re: Question!!what small bugs in empty water dish

    i let her roam around my room for couple days and in that time i decided to clean out the tank..and i was looking at the caliclum build up in the water dish and that when i noticed about 5 little(pix soon) bugs runnin around in it. i cleaned the dish out with CLR. but now imma leave it empty to c if they come back in there to get a pic of them.

  5. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Question!!what small bugs in empty water dish

    Quote Originally Posted by Texas Dan View Post
    I'm not trying to argue here with you, not what I wanted to do at all. I'm just saying, prepare for the worst, and if they are harmless, oh well. At least if they get PAM they are doing something active.

    Sorry if I sounded high and mighty, not was I was going for.
    My apologies as well. I am in a bit of a tift with someone on another forum and I let it boil over to here. I did perceive your intent to be somewhat of a challenge to me but even then my response was over the top. Sorry.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #16
    BPnet Veteran Texas Dan's Avatar
    Join Date
    02-19-2008
    Location
    Dallas, TX
    Posts
    836
    Thanks
    12
    Thanked 24 Times in 16 Posts
    Images: 2

    Re: Question!!what small bugs in empty water dish

    Quote Originally Posted by asplundii View Post
    My apologies as well. I am in a bit of a tift with someone on another forum and I let it boil over to here. I did perceive your intent to be somewhat of a challenge to me but even then my response was over the top. Sorry.
    NP. I just didn't want them to give up there and not get treatment if it's needed. Everyone has bad days, then it sounds like everyone is against you.
    1.0.0 Normal BP: Vincent Vega

  7. #17
    BPnet Veteran broadude's Avatar
    Join Date
    05-20-2005
    Location
    United States
    Posts
    731
    Thanks
    477
    Thanked 101 Times in 84 Posts

    Re: Question!!what small bugs in empty water dish

    I am a bit queasy about the thought that even if springs are "harmless" they are allowed to roam at will.

    Here's my reasoning (bear with me) I wouldn't want bugs crawling over me (ohhhh the visual!! yeech). They (snakes) can't swat them away, can't get away from them and have them "springing" off their eyes, etc.. also getting in the snakes waterdish and drowning..

    I treat all the substrate that comes in with PAM before putting the substrate in the tubs. By this I mean I divide the bags (use trash bags) and spray each group of substrate..shake and close the bag and use the next day or week. By then it is dried and anything living in it should be dead.

    I am NOT saying that anyone must do it my way. I am stating an opinion only.
    Last edited by broadude; 01-16-2009 at 04:52 PM. Reason: added a comment


    "Price has very little to do with QUALITY. Quality stands on its own merit and doesn't need a hefty price tag to prove its worth."

  8. #18
    BPnet Veteran Lucas339's Avatar
    Join Date
    10-08-2008
    Location
    Fort Pierce
    Posts
    2,104
    Thanks
    158
    Thanked 389 Times in 366 Posts
    Images: 2

    Re: Question!!what small bugs in empty water dish

    Quote Originally Posted by echo0587 View Post
    i let her roam around my room for couple days and in that time i decided to clean out the tank..and i was looking at the caliclum build up in the water dish and that when i noticed about 5 little(pix soon) bugs runnin around in it. i cleaned the dish out with CLR. but now imma leave it empty to c if they come back in there to get a pic of them.

    just push around some of the substrate and if they are spring tails, you should see them running about. the ones in my substrate are whiteish.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1