Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 735

2 members and 733 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,114
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 18

Threaded View

  1. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Question!!what small bugs in empty water dish

    Quote Originally Posted by Texas Dan View Post
    You're going to say this and you don't know what he's talking about? I don't see a picture here,maybe because i'm at work. But saying "it's totally harmless" is the wrong way to go.

    At least get a can of PAM, it can't hurt. (unless you use it wrong) And will probably kill whatever it is.
    I hate to sound like an twit but you do not know what he is talking about either so kindly do not get all high and mighty on me.

    With no picture, no I can not say for certain that it is spring tails but neither can you say it is mites. You said it was likely mites and that he should get the PAM. Fine, you are entitled to your opinion (and it is just that cause there is no pic so you really do not know what it is he is talking about.) I said it was likely spring tails which are harmless and if it is indeed spring tails then yes, I bloody well can say they are harmless. They are not parasitic, they do not carry animal borne pathogens... So, plain and simple spring tails are totally harmless. And, as you are entitled to your opinion so too am I entitled to mine (and it is just that cause there is no pic so I really do not know what it is he is talking about either.)

    Quote Originally Posted by Lucas339 View Post
    i have them in my chondro cage. nothing to worry about
    Ditto. And my GBK cage and all my ball cages and my egg eater cages and my carpet cage and my Dendro tank and my Phyllomedusa tank. Springs eat detritus, nothing to worry about at all.

    .....but a picture is a must for us to be able to tell the difference. what color are they??
    Yes, I agree. A pic would help significantly. Behavior is a good indicator too cause springs and mites behave very different. Namely, springs will "spring" away if you bring your finger near them.
    Last edited by asplundii; 01-16-2009 at 01:17 PM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1