» Site Navigation
0 members and 692 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,105
Posts: 2,572,113
Top Poster: JLC (31,651)
|
-
Re: Question!!what small bugs in empty water dish
 Originally Posted by asplundii
I am more inclined to believe they are spring tails. Rather common in organic/wood mulches and they have a prediliction for congregating around water. Totally harmless.
i have them in my chondro cage. nothing to worry about.....but a picture is a must for us to be able to tell the difference. what color are they??
-
-
Re: Question!!what small bugs in empty water dish
 Originally Posted by Texas Dan
You're going to say this and you don't know what he's talking about? I don't see a picture here,maybe because i'm at work. But saying "it's totally harmless" is the wrong way to go.
At least get a can of PAM, it can't hurt. (unless you use it wrong) And will probably kill whatever it is.
I hate to sound like an twit but you do not know what he is talking about either so kindly do not get all high and mighty on me.
With no picture, no I can not say for certain that it is spring tails but neither can you say it is mites. You said it was likely mites and that he should get the PAM. Fine, you are entitled to your opinion (and it is just that cause there is no pic so you really do not know what it is he is talking about.) I said it was likely spring tails which are harmless and if it is indeed spring tails then yes, I bloody well can say they are harmless. They are not parasitic, they do not carry animal borne pathogens... So, plain and simple spring tails are totally harmless. And, as you are entitled to your opinion so too am I entitled to mine (and it is just that cause there is no pic so I really do not know what it is he is talking about either.)
 Originally Posted by Lucas339
i have them in my chondro cage. nothing to worry about
Ditto. And my GBK cage and all my ball cages and my egg eater cages and my carpet cage and my Dendro tank and my Phyllomedusa tank. Springs eat detritus, nothing to worry about at all.
.....but a picture is a must for us to be able to tell the difference. what color are they??
Yes, I agree. A pic would help significantly. Behavior is a good indicator too cause springs and mites behave very different. Namely, springs will "spring" away if you bring your finger near them.
Last edited by asplundii; 01-16-2009 at 01:17 PM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
 Originally Posted by asplundii
I hate to sound like an twit but you do not know what he is talking about either so kindly do not get all high and mighty on me.
With no picture, no I can not say for certain that it is spring tails but neither can you say it is mites. You said it was likely mites and that he should get the PAM. Fine, you are entitled to your opinion (and it is just that cause there is no pic so you really do not know what it is he is talking about.) I said it was likely spring tails which are harmless and if it is indeed spring tails then yes, I bloody well can say they are harmless. They are not parasitic, they do not carry animal borne pathogens... So, plain and simple spring tails are totally harmless. And, as you are entitled to your opinion so too am I entitled to mine (and it is just that cause there is no pic so I really do not know what it is he is talking about either.)
I'm not trying to argue here with you, not what I wanted to do at all. I'm just saying, prepare for the worst, and if they are harmless, oh well. At least if they get PAM they are doing something active.
Sorry if I sounded high and mighty, not was I was going for.
1.0.0 Normal BP: Vincent Vega
-
-
Registered User
Re: Question!!what small bugs in empty water dish
i let her roam around my room for couple days and in that time i decided to clean out the tank..and i was looking at the caliclum build up in the water dish and that when i noticed about 5 little(pix soon) bugs runnin around in it. i cleaned the dish out with CLR. but now imma leave it empty to c if they come back in there to get a pic of them.
-
-
Re: Question!!what small bugs in empty water dish
 Originally Posted by Texas Dan
I'm not trying to argue here with you, not what I wanted to do at all. I'm just saying, prepare for the worst, and if they are harmless, oh well. At least if they get PAM they are doing something active.
Sorry if I sounded high and mighty, not was I was going for.
My apologies as well. I am in a bit of a tift with someone on another forum and I let it boil over to here. I did perceive your intent to be somewhat of a challenge to me but even then my response was over the top. Sorry.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
 Originally Posted by asplundii
My apologies as well. I am in a bit of a tift with someone on another forum and I let it boil over to here. I did perceive your intent to be somewhat of a challenge to me but even then my response was over the top. Sorry.
NP. I just didn't want them to give up there and not get treatment if it's needed. Everyone has bad days, then it sounds like everyone is against you.
1.0.0 Normal BP: Vincent Vega
-
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
I am a bit queasy about the thought that even if springs are "harmless" they are allowed to roam at will.
Here's my reasoning (bear with me) I wouldn't want bugs crawling over me (ohhhh the visual!! yeech). They (snakes) can't swat them away, can't get away from them and have them "springing" off their eyes, etc.. also getting in the snakes waterdish and drowning..
I treat all the substrate that comes in with PAM before putting the substrate in the tubs. By this I mean I divide the bags (use trash bags) and spray each group of substrate..shake and close the bag and use the next day or week. By then it is dried and anything living in it should be dead.
I am NOT saying that anyone must do it my way. I am stating an opinion only.
Last edited by broadude; 01-16-2009 at 04:52 PM.
Reason: added a comment
"Price has very little to do with QUALITY. Quality stands on its own merit and doesn't need a hefty price tag to prove its worth."
-
-
Re: Question!!what small bugs in empty water dish
 Originally Posted by echo0587
i let her roam around my room for couple days and in that time i decided to clean out the tank..and i was looking at the caliclum build up in the water dish and that when i noticed about 5 little(pix soon) bugs runnin around in it. i cleaned the dish out with CLR. but now imma leave it empty to c if they come back in there to get a pic of them.
just push around some of the substrate and if they are spring tails, you should see them running about. the ones in my substrate are whiteish.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|