Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,167

0 members and 1,167 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,146
Posts: 2,572,379
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 3 of 10 FirstFirst 12345678910 LastLast
Results 21 to 30 of 100
  1. #21
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Blog Entries
    2
    Images: 46

    Re: Genetic "flaws" associated with various morphs?

    Quote Originally Posted by shimmer View Post
    Don't buy from BHB. I have seen and heard way to many problems with this company. They are like the Walmart of BP breeders and I personally would never buy from them. Ralph Davis, LLLReptile, and Mike Wilbanks/Bob Clark are all very good breeders. Ralph only does phone orders which shows he really does care about his animals. Don't Buy from Petco or Petsmart they get their stock from Rainbow Exotics and other Bad Breeders that often have bad breeding and caring conditions and practices.
    If you have had a transaction with Brian that wasn't resolved to your satisfaction, feel free to share that with others in our feedback section. But this thread is not the place to make unsubstantiated claims of "problems" with them based on what you've "heard".

  2. The Following User Says Thank You to rabernet For This Useful Post:

    iCandiBallPythons (01-15-2009)

  3. #22
    BPnet Veteran Wh00h0069's Avatar
    Join Date
    12-30-2007
    Location
    Middletown, OH
    Posts
    4,349
    Thanks
    915
    Thanked 832 Times in 736 Posts
    Images: 8

    Re: Genetic "flaws" associated with various morphs?

    Quote Originally Posted by Bruce Whitehead View Post
    Is that ice? HI-YA!!!

    (do ninjas break ice?).
    Eddie Strong, Jr.

  4. #23
    BPnet Veteran Wh00h0069's Avatar
    Join Date
    12-30-2007
    Location
    Middletown, OH
    Posts
    4,349
    Thanks
    915
    Thanked 832 Times in 736 Posts
    Images: 8

    Re: Genetic "flaws" associated with various morphs?

    Quote Originally Posted by shimmer View Post
    Don't buy from BHB. I have seen and heard way to many problems with this company. They are like the Walmart of BP breeders and I personally would never buy from them.
    I disagree!! I have never bought from BHB, but would in a hearbeat.
    Eddie Strong, Jr.

  5. #24
    BPnet Veteran Wh00h0069's Avatar
    Join Date
    12-30-2007
    Location
    Middletown, OH
    Posts
    4,349
    Thanks
    915
    Thanked 832 Times in 736 Posts
    Images: 8

    Re: Genetic "flaws" associated with various morphs?

    Quote Originally Posted by shimmer View Post
    LLLReptile, and Mike Wilbanks/Bob Clark are all very good breeders.
    I have heard the complete opposite from many other people. Personally, I would not buy from any of the above.
    Eddie Strong, Jr.

  6. #25
    BPnet Veteran Lucas339's Avatar
    Join Date
    10-08-2008
    Location
    Fort Pierce
    Posts
    2,104
    Thanks
    158
    Thanked 389 Times in 366 Posts
    Images: 2

    Re: Genetic "flaws" associated with various morphs?

    LLL is a broker. they have ads on kingsnake all the time saying we will buy your offspring. they don't breed in the least. Ive herd many bad things about Clark, just check the BOI on fauna. and i wouldn't hessitate to buy from BHB!

    now back to what the actual thread was about....ive herd about all the defects assocaited with the morphs. but come on! does it get better than bees?!?!? i mean any of them?!?! they are really stunning animals and if i have to have a wobbily spider to get some then so be it! from what i herd, the wobbles for the most part don't affect the animal too much.

    carmels and kinks.....i'd still shoot for them! i love this morph and hopefully, one day get into it. Im suprised you don't see more combos with this morph!

    and i love the super cinnys and hope to one day have those. i too like to gamble only i disagree stongly with euthinizing an animal that can live even if it is defected. just because the animal isn't going to make you money (and in this case this is what it boils down to) by being a breeder doesn't mean you should kill it. as a breeder it is your responsibility to care for this animal! ralph davis does it! and i saw a you tube video of a guy (not sure but it might be davis) who had several kinked carmels that he kept because they eat and poop and shed fine but he doesn't breed them. don't forget that we are supposed to be breeding because we love these animals and if you are doing it for the money, then get another hobby! i HIGHLY disagree with putting an animal down if it can't be a breeder. now if the animal is too deformed to go through life properly.....like it can't eat or is prone to infections ect. then maybe something should be done.

    just my .02 cents on something that really bothers me!!

  7. The Following 2 Users Say Thank You to Lucas339 For This Useful Post:

    771subliminal (12-23-2008),FatBoy (12-23-2008)

  8. #26
    Registered User
    Join Date
    11-13-2008
    Posts
    121
    Thanks
    2
    Thanked 12 Times in 9 Posts

    Re: Genetic "flaws" associated with various morphs?

    I recently bought 17 ball pythons from Brian and I couldn't be happier with them. And for the record I live in Sweden and the shipping went perfect as well, can't see what the problems with Brian would be. In my world Brian is a stand up guy who is VERY service minded, grade A purchase from beginning to end. I would recommend him to anyone.

  9. The Following 4 Users Say Thank You to Doxster For This Useful Post:

    771subliminal (12-23-2008),broadude (12-23-2008),littleindiangirl (12-23-2008),Wh00h0069 (12-23-2008)

  10. #27
    BPnet Veteran hoax's Avatar
    Join Date
    07-06-2008
    Location
    Cleburne, TX
    Posts
    1,562
    Thanks
    1,110
    Thanked 331 Times in 206 Posts
    Images: 7

    Re: Genetic "flaws" associated with various morphs?

    Quote Originally Posted by shimmer View Post
    Don't buy from BHB. I have seen and heard way to many problems with this company. They are like the Walmart of BP breeders and I personally would never buy from them. Ralph Davis, LLLReptile, and Mike Wilbanks/Bob Clark are all very good breeders. Ralph only does phone orders which shows he really does care about his animals. Don't Buy from Petco or Petsmart they get their stock from Rainbow Exotics and other Bad Breeders that often have bad breeding and caring conditions and practices.
    This is full of stupidity. I have never dealt with BHB personally but I have never heard any thing but good about him. I would buy from BHB in a heart beat.

    Ralph Davis is the only other breeder I have heard extensively about and I would buy from Ralph just as fast as BHB.

    I am currently dealing with Adam Wysocki over at 8ball. He has stated that ALL spiders wobble. He made this comment some time ago I do not know if this is how he still feels.

    I would never buy from petsmart or petco. I know that petsmart sells CH BPs. I would not want to buy a CH or WC simply because there are plenty to buy that are CB. I think as a whole we should try to preserve the native species and try to only buy CB if at all possible. I do know that to some extent we do need WC in our hobby to introduce new morphs.

    I personally have heard nothing about the duck bill problem with some of the morphs this is most likely due to my ignorance. If some one could help me understand this I would be grateful.

    As far as the kinks in the caramels I would like to work with them due to their potential but I do not want to have to risk throwing an animal in the freezer I would not like to keep an animal that is kinked it would be taking up space that I would need for useful breeding animals. I would have one to just keep and enjoy but I do not think I would want to breed them.

    I would be willing to work with a good line of spiders. I will be buying spiders in the future to produce some of the great morph that require them. I also think that spiders are beautiful on their own and would like to produce them.
    Pastel 0.1
    Mojo 1.0
    100% Het albino 1.1
    50% Het Albino 0.1
    -
    Do you like Texas BBQ? Do you want to know where I will be so you can get some?>>>>>My Catering Company Facebook Page<<<<<
    reptilebasics.com Rich is awesome - texas4x4.org -pirate4x4.com

  11. #28
    BPnet Lifer muddoc's Avatar
    Join Date
    03-23-2006
    Location
    Louisiana
    Posts
    5,340
    Thanks
    1,202
    Thanked 1,606 Times in 618 Posts
    Images: 49

    Re: Genetic "flaws" associated with various morphs?

    Quote Originally Posted by Bruce Whitehead View Post
    I said that " if not fatal should exist"... in that if it is not fatal, then they should exist. So if even one exists, then that invalidates the theory that homozygous are fatal.

    Personally I never bought that it was fatal, but I do not have enough experience with them to know (just got my first two spider girls this year).

    It does not make sense to me that it could not exist in a homozygous form, but again, I have never bred spiders to know that for sure.

    Bruce

    PS: Did that make sense?
    Bruce,
    Made perfect sense. I was just thinking you may have some info that I didn't know about. I am always on the quest for as much knowledge as I can soak up.

    Thanks for the reply,
    Tim Bailey
    (A.K.A. MBM or Art Pimp)
    www.baileyreptiles.com
    The Blog

  12. #29
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Genetic "flaws" associated with various morphs?

    Quote Originally Posted by Bruce Whitehead View Post
    It does not make sense to me that it could not exist in a homozygous form, but again, I have never bred spiders to know that for sure.
    Slightly tangential. There are traits that are stable as heterozygous form but lethal as homozygous form. The Jaguar morph of carpet pythons is one of these. The jag phenotype is a result of the heterozygous condition. A homozygous jag is very much a dead animal.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. #30
    Single Serving Friend jsmorphs2's Avatar
    Join Date
    12-04-2008
    Location
    Colorado Springs
    Posts
    2,305
    Thanks
    1,018
    Thanked 659 Times in 517 Posts
    Images: 212

    Re: Genetic "flaws" associated with various morphs?

    My spider "spins". The behavior or defect is only noticeable if she is climbing up something. It almost seems like she has a loss of balance. While climbing she will start going up (say up my arm) then as she gets to a vertical surface her head will go back words and she usually turns to go another direction. It doesn't affect her in any way so I have not worried about it. I would only caution that if you have a spider with balance/climbing issues to keep a close eye and good grip on it when its being handled to prevent a fall.
    ~Jessica~

  14. The Following User Says Thank You to jsmorphs2 For This Useful Post:

    aaschmitt (12-23-2008)

Page 3 of 10 FirstFirst 12345678910 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1