» Site Navigation
0 members and 759 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,067
Threads: 249,217
Posts: 2,572,780
Top Poster: JLC (31,651)
|
-
Re: Genetic "flaws" associated with various morphs?
 Originally Posted by shimmer
Don't buy from BHB. I have seen and heard way to many problems with this company. They are like the Walmart of BP breeders and I personally would never buy from them. Ralph Davis, LLLReptile, and Mike Wilbanks/Bob Clark are all very good breeders. Ralph only does phone orders which shows he really does care about his animals. Don't Buy from Petco or Petsmart they get their stock from Rainbow Exotics and other Bad Breeders that often have bad breeding and caring conditions and practices.
If you have had a transaction with Brian that wasn't resolved to your satisfaction, feel free to share that with others in our feedback section. But this thread is not the place to make unsubstantiated claims of "problems" with them based on what you've "heard".
-
The Following User Says Thank You to rabernet For This Useful Post:
-
Re: Genetic "flaws" associated with various morphs?
 Originally Posted by Bruce Whitehead
Is that ice? HI-YA!!!
(do ninjas break ice?).
Eddie Strong, Jr. 
-
-
Re: Genetic "flaws" associated with various morphs?
 Originally Posted by shimmer
Don't buy from BHB. I have seen and heard way to many problems with this company. They are like the Walmart of BP breeders and I personally would never buy from them.
I disagree!! I have never bought from BHB, but would in a hearbeat.
Eddie Strong, Jr. 
-
-
Re: Genetic "flaws" associated with various morphs?
 Originally Posted by shimmer
LLLReptile, and Mike Wilbanks/Bob Clark are all very good breeders.
I have heard the complete opposite from many other people. Personally, I would not buy from any of the above.
Eddie Strong, Jr. 
-
-
Re: Genetic "flaws" associated with various morphs?
LLL is a broker. they have ads on kingsnake all the time saying we will buy your offspring. they don't breed in the least. Ive herd many bad things about Clark, just check the BOI on fauna. and i wouldn't hessitate to buy from BHB!
now back to what the actual thread was about....ive herd about all the defects assocaited with the morphs. but come on! does it get better than bees?!?!? i mean any of them?!?! they are really stunning animals and if i have to have a wobbily spider to get some then so be it! from what i herd, the wobbles for the most part don't affect the animal too much.
carmels and kinks.....i'd still shoot for them! i love this morph and hopefully, one day get into it. Im suprised you don't see more combos with this morph!
and i love the super cinnys and hope to one day have those. i too like to gamble only i disagree stongly with euthinizing an animal that can live even if it is defected. just because the animal isn't going to make you money (and in this case this is what it boils down to) by being a breeder doesn't mean you should kill it. as a breeder it is your responsibility to care for this animal! ralph davis does it! and i saw a you tube video of a guy (not sure but it might be davis) who had several kinked carmels that he kept because they eat and poop and shed fine but he doesn't breed them. don't forget that we are supposed to be breeding because we love these animals and if you are doing it for the money, then get another hobby! i HIGHLY disagree with putting an animal down if it can't be a breeder. now if the animal is too deformed to go through life properly.....like it can't eat or is prone to infections ect. then maybe something should be done.
just my .02 cents on something that really bothers me!!
-
The Following 2 Users Say Thank You to Lucas339 For This Useful Post:
771subliminal (12-23-2008),FatBoy (12-23-2008)
-
Registered User
Re: Genetic "flaws" associated with various morphs?
I recently bought 17 ball pythons from Brian and I couldn't be happier with them. And for the record I live in Sweden and the shipping went perfect as well, can't see what the problems with Brian would be. In my world Brian is a stand up guy who is VERY service minded, grade A purchase from beginning to end. I would recommend him to anyone.
-
The Following 4 Users Say Thank You to Doxster For This Useful Post:
771subliminal (12-23-2008),broadude (12-23-2008),littleindiangirl (12-23-2008),Wh00h0069 (12-23-2008)
-
BPnet Veteran
Re: Genetic "flaws" associated with various morphs?
 Originally Posted by shimmer
Don't buy from BHB. I have seen and heard way to many problems with this company. They are like the Walmart of BP breeders and I personally would never buy from them. Ralph Davis, LLLReptile, and Mike Wilbanks/Bob Clark are all very good breeders. Ralph only does phone orders which shows he really does care about his animals. Don't Buy from Petco or Petsmart they get their stock from Rainbow Exotics and other Bad Breeders that often have bad breeding and caring conditions and practices.
This is full of stupidity. I have never dealt with BHB personally but I have never heard any thing but good about him. I would buy from BHB in a heart beat.
Ralph Davis is the only other breeder I have heard extensively about and I would buy from Ralph just as fast as BHB.
I am currently dealing with Adam Wysocki over at 8ball. He has stated that ALL spiders wobble. He made this comment some time ago I do not know if this is how he still feels.
I would never buy from petsmart or petco. I know that petsmart sells CH BPs. I would not want to buy a CH or WC simply because there are plenty to buy that are CB. I think as a whole we should try to preserve the native species and try to only buy CB if at all possible. I do know that to some extent we do need WC in our hobby to introduce new morphs.
I personally have heard nothing about the duck bill problem with some of the morphs this is most likely due to my ignorance. If some one could help me understand this I would be grateful.
As far as the kinks in the caramels I would like to work with them due to their potential but I do not want to have to risk throwing an animal in the freezer I would not like to keep an animal that is kinked it would be taking up space that I would need for useful breeding animals. I would have one to just keep and enjoy but I do not think I would want to breed them.
I would be willing to work with a good line of spiders. I will be buying spiders in the future to produce some of the great morph that require them. I also think that spiders are beautiful on their own and would like to produce them.
-
-
Re: Genetic "flaws" associated with various morphs?
 Originally Posted by Bruce Whitehead
I said that " if not fatal should exist"... in that if it is not fatal, then they should exist. So if even one exists, then that invalidates the theory that homozygous are fatal.
Personally I never bought that it was fatal, but I do not have enough experience with them to know (just got my first two spider girls this year).
It does not make sense to me that it could not exist in a homozygous form, but again, I have never bred spiders to know that for sure.
Bruce
PS: Did that make sense?
Bruce,
Made perfect sense. I was just thinking you may have some info that I didn't know about. I am always on the quest for as much knowledge as I can soak up.
Thanks for the reply,
-
-
Re: Genetic "flaws" associated with various morphs?
 Originally Posted by Bruce Whitehead
It does not make sense to me that it could not exist in a homozygous form, but again, I have never bred spiders to know that for sure.
Slightly tangential. There are traits that are stable as heterozygous form but lethal as homozygous form. The Jaguar morph of carpet pythons is one of these. The jag phenotype is a result of the heterozygous condition. A homozygous jag is very much a dead animal.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Genetic "flaws" associated with various morphs?
My spider "spins". The behavior or defect is only noticeable if she is climbing up something. It almost seems like she has a loss of balance. While climbing she will start going up (say up my arm) then as she gets to a vertical surface her head will go back words and she usually turns to go another direction. It doesn't affect her in any way so I have not worried about it. I would only caution that if you have a spider with balance/climbing issues to keep a close eye and good grip on it when its being handled to prevent a fall.
~Jessica~

-
The Following User Says Thank You to jsmorphs2 For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|