Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 593

0 members and 593 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,117
Posts: 2,572,190
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 18

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Ghost Genetics Question

    A. Pastel 100% Het Ghost x 100% het Ghost =

    12.5% WT
    25% Het. Hypo,
    12.5% Hypo,
    12.5% Pastel,
    25% Pastel, Het. Hypo,
    12.5% Pastel, Hypo,

    B. Pastel 100% Het Ghost x Pastel 100% Het Ghost =

    6.25% WT
    12.5% Het. Hypo,
    6.25% Hypo,
    12.5% Pastel,
    25% Pastel, Het. Hypo,
    12.5% Pastel, Hypo,
    6.25% Super Pastel,
    12.5% Super Pastelc, Het. Hypo,
    6.25% Super Pastel, Hypo

    C. Pastel 100% Het Ghost x Ghost

    25% Het. Hypo,
    25% Hypo,
    25% Pastel, Het. Hypo,
    25% Pastelc, Hypo,

    D. Pastel 100% Het Ghost x Normal

    25% WT
    25% Het. Hypo,
    25% Pastel,
    25% Pastel, Het. Hypo,

    E. Pastel 100% Het Ghost x Pastel

    12.5% WT
    12.5% Het. Hypo,
    25% Pastel,
    25% Pastel, Het. Hypo,
    12.5% Super Pastel,
    12.5% Super Pastel, Het. Hypo
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Beardedragon (12-31-2008)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1