» Site Navigation
0 members and 2,141 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
|
-
Registered User
Re: Is there a way to tell het pied on appearance?
-
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by mooingtricycle
LOL i think its because they dont factor in that is part of the Wild Type Make up. " we see hundreds of het pieds with this marker"
yeah... Ive got/had normals with the same darn marker too, and a het pied without them!!!! 
Like I said, there is more to it than just belly stripes. I have had normals with the striping as well, but it's not even close. ALL of my het pieds, and possible hets with markers, have the same visual charasteristics added to the striping.
Again I'll ask, why did the largest producer of Pieds in the world hold back all of this possible hets and sell the 100% hets? From what I know, the marker was first discovered by him.
Will some hets not have the marker? Yes. The point is, when buying possible hets, look for the ones with markers and avoid the ones without. Will some normals have markers similar? Yes, but not exactly. It is not just about the stripes.
-
The Following User Says Thank You to Brandon Osborne For This Useful Post:
-
Registered User
Re: Is there a way to tell het pied on appearance?
Brandon very clearly put
-
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by asplundii
To me, if the marker was a product of the allele then there should be a 1:1 correlation which we do not have. However, if it is a case of linkage from inadvertent selective breeding that explains why you still get the 100% hets who look normal.
We seem to have several examples of sporadic traits that give every indication of being part of the mutations we are breeding for. I don't know what controls when they get expressed and when they don't.
1. The wobble in spiders. If it wasn't a side effect of the actual spider mutation surely the linkage would be broken with all the spider outbreeding by now and someone would be selling a line of guaranteed 100% non looping spiders.
2. Kinking in caramels. Although recessive there has also been a lot of work on outbreeding but still many caramels kink but not 100% of them.
3. Kinking and duck bill in homozygous cinnamon/black pastel. Same thing, seen consistently but not always.
4. Some but not all het granite Burmese pythons with the puzzle pattern that is intermediate between normal and granite.
5. Some but not all het green Burmese pythons with the cinnamon pattern/color that is intermediate between normal and green.
These non absolutes aren't neat and tidy but they seem to be real even though they are seen sporadically. To me the wide white belly with dark lines at the edge and intricate and bright back pattern seen in many but not all het pieds looks a lot like the start of the pied white creeping up from the belly and the dark lines and bright color seen in the non white areas of a homozygous pied. Maybe being homozygous pied and to a lesser degree het pied resists the migration of color from the neural crest down leaving the white belly and in a homozygous pied also white some places on the back. Just like homozygous pieds vary in how restricted the color is (i.e. how high the white is) perhaps the hets can vary too due to other genetics, chance, or perhaps even incubation environment.
-
The Following User Says Thank You to RandyRemington For This Useful Post:
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by RandyRemington
We seem to have several examples of sporadic traits that give every indication of being part of the mutations we are breeding for. I don't know what controls when they get expressed and when they don't.
I'll start by saying I know jack about Burms so I am not going to even try to address them but:
1. The wobble in spiders. If it wasn't a side effect of the actual spider mutation surely the linkage would be broken with all the spider outbreeding by now and someone would be selling a line of guaranteed 100% non looping spiders.
I do not have a lot of first hand experience with spiders but all I have read and heard form the tops in the game indicates that all spiders wobble to some extent or another. Additionally, like the Jag morph in carpets, all spiders are reported to be a little "off" in other ways.
2. Kinking in caramels. Although recessive there has also been a lot of work on outbreeding but still many caramels kink but not 100% of them.
Granted not all caramels kink, but you never see a higher rate of kinking in the hets do you? The kinking condition is a result of a pathway disruption that is only there when both recessive alleles are present, in the presence of a WT allele there is no indication that the animal is a het unless you know that based on breeding.
3. Kinking and duck bill in homozygous cinnamon/black pastel. Same thing, seen consistently but not always.
Again, you are talking homozygous vs. heterozygous condition. The specific condition is the result of a homozygous induced disruption. In the heterozygous condition there is no indication of any other factor associate.
These non absolutes aren't neat and tidy but they seem to be real even though they are seen sporadically. To me the wide white belly with dark lines at the edge and intricate and bright back pattern seen in many but not all het pieds looks a lot like the start of the pied white creeping up from the belly and the dark lines and bright color seen in the non white areas of a homozygous pied. Maybe being homozygous pied and to a lesser degree het pied resists the migration of color from the neural crest down leaving the white belly and in a homozygous pied also white some places on the back. Just like homozygous pieds vary in how restricted the color is (i.e. how high the white is) perhaps the hets can vary too due to other genetics, chance, or perhaps even incubation environment.
I do not deny that the above mentioned conditions are real but I do not think they are exactly in the same range of condition as the het pied marker. If pied is a recessive trait then the hets should be phenotype WT. If they are not phenotype WT then pied has to be a co-dom trait (albeit a state where the het form is a very very subtle one but we have that like with a few other morphs so it is not unheard of.)
Honestly I have no real stance either way, I am just playing devil's advocate. And it still seems that no one is willing to even consider that the marker could very well be the result of unintentional selective breeding.
Look at it in this manner:
When someone is breeding a pastel to a WT they usually pick a WT with high yellow/gold so as to enhance the pastel effect (why breed a pastel to a dark animal if it is just going to give you sub par pastels?) As a result, WT offspring from pastel breedings tend to be higher yellow animals.
Now apply this same logic to pied breedings in terms of accidental marker selection. A "preferred" way of breeding for recessive traits is to breed the homozygous recessive to a het so that all offspring are either the recessive or 100% hets. Now, some how (does not matter if it was accident or intent) the marker was assigned as a trait of het pieds. Someone gets an animal with the marker and breeds it to their pied. Only hets were produced in the clutch, and for arguments sake say half have the marker. Now, marker and pied are separate but because of the correlation assigned to the marker more people are inclined to breed the marker animals in their projects. A couple rounds of breeding marker carrying het pieds and you have enriched for the marker trait in offspring of pied breedings in the same manner that you have enriched for high yellow animals in pastel breedings.
Granted, I could be wrong. More than happy to admit that. All I am trying to do is offer and argument that many people seem to be ignoring as a possibility.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Is there a way to tell het pied on appearance?
I've wondered something similar relative to "marker" het pieds versus "non-marker"
Just for sake of arguement (and to cull my hypothesis) what if there were 2 lines of pieds which were compatible? Similar to how mojave and lesser interact (only that in the pied example the combined homozygous offspring is indistinguishable from same gene homozygous).
Say there is a "co-dom" marker pied gene that is compatible with a truely recessive pied gene?
One's with markers could potentially produce homozygous pieds if bred to other markers or they could be bred to true het pieds (non-marker) and produce pieds.
And....just as the previous poster mentioned selective breeding has selected fewer het pieds without the markers?
Just throwing that out there wondering if that's a possiblility?
Easy enough to prove right? Breed marker to marker and then breed the resulting pied to normals to see if you get all markers? Maybe this has been proven otherwise but I thought it was a fun idea. 
Great discussion guys!
-
-
Re: Is there a way to tell het pied on appearance?
I've actually considered this approach, but what about all the clutches from breeding hets with markers, to completely unrelated normals? In my experience, 50% of the offspring have had the marker from doing this, and as you point out, 100% of actual 100% hets have carried the marker including those bred to pastels. I strongly believe the traits are much more than coincidence.
Brandon
 Originally Posted by asplundii
Honestly I have no real stance either way, I am just playing devil's advocate. And it still seems that no one is willing to even consider that the marker could very well be the result of unintentional selective breeding.
Look at it in this manner:
When someone is breeding a pastel to a WT they usually pick a WT with high yellow/gold so as to enhance the pastel effect (why breed a pastel to a dark animal if it is just going to give you sub par pastels?) As a result, WT offspring from pastel breedings tend to be higher yellow animals.
Now apply this same logic to pied breedings in terms of accidental marker selection. A "preferred" way of breeding for recessive traits is to breed the homozygous recessive to a het so that all offspring are either the recessive or 100% hets. Now, some how (does not matter if it was accident or intent) the marker was assigned as a trait of het pieds. Someone gets an animal with the marker and breeds it to their pied. Only hets were produced in the clutch, and for arguments sake say half have the marker. Now, marker and pied are separate but because of the correlation assigned to the marker more people are inclined to breed the marker animals in their projects. A couple rounds of breeding marker carrying het pieds and you have enriched for the marker trait in offspring of pied breedings in the same manner that you have enriched for high yellow animals in pastel breedings.
Granted, I could be wrong. More than happy to admit that. All I am trying to do is offer and argument that many people seem to be ignoring as a possibility.
-
-
Registered User
Re: Is there a way to tell het pied on appearance?
[QUOTE=RandyRemington;934765]
1. The wobble in spiders. If it wasn't a side effect of the actual spider mutation surely the linkage would be broken with all the spider outbreeding by now and someone would be selling a line of guaranteed 100% non looping spiders.
wow very nicely put, I think from here on out when somebody questions me how I feel about spiders wobbling and if they all have it, I am going to tell them exactly what you just wrote. I agree with you 150percent. Great job!
-
-
Re: Is there a way to tell het pied on appearance?
Brandon,
I am not certain I understand what you are saying here so let me take a stab at what I think you are getting at and if I am wrong please do correct me.
 Originally Posted by Brandon Osborne
but what about all the clutches from breeding hets with markers, to completely unrelated normals? In my experience, 50% of the offspring have had the marker from doing this
Okay so in a marker het x WT breeding say we get a 6 egg clutch. 3 of the offspring have marker (call them m3) and 3 do not (call them p3).
and as you point out, 100% of actual 100% hets have carried the marker including those bred to pastels.
This is where I get confused because:
1) I do not think I said 100% of actual 100% hets carried the marker except in a very specific case where a pied animal was bred to an animal with the marker that may or may not have actually been a het. It is only in that very specific case that you could you guarantee that 100% of the marker animals were 100% het. The traits could still be unrelated because, in this example, the marker trait comes from the marker parent and the het allele comes from the pied parent.
2) I was not talking about breeding pieds to pastels so I am not sure what you are driving at there...
But, if I am reading it the way I think you are saying it then I think what you are saying is that the m3 animals and only the m3 animals in the breeding example from above are het pied and the p3 animals are simply WT. I do not think you can guarantee that this is necessarily the case 100% of the time. This would perpetuate the cycle though if it is assumed that only the m3 animals were the hets because people would be more likely to snatch those up and breed them in their projects which further perpetuates the enrichment of the marker trait in the pied pool. Those that do not have the marker are less likely to be used in breeding projects and so the "unmarked trait" is thereby selected against in the pied pool.
It is selfish gene theory. Same reason all female peacocks carry the gene for long tails
I strongly believe the traits are much more than coincidence.
And, as I said, that may well be and I am more than willing to admit it. I am just arguing the case as devil's advocate, mostly because I feel it is a possibility that many people do not consider. Occam's razor is not always the right way of looking at things
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Is there a way to tell het pied on appearance?
 Originally Posted by asplundii
Now apply this same logic to pied breedings in terms of accidental marker selection. A "preferred" way of breeding for recessive traits is to breed the homozygous recessive to a het so that all offspring are either the recessive or 100% hets. Now, some how (does not matter if it was accident or intent) the marker was assigned as a trait of het pieds. Someone gets an animal with the marker and breeds it to their pied. Only hets were produced in the clutch, and for arguments sake say half have the marker. Now, marker and pied are separate but because of the correlation assigned to the marker more people are inclined to breed the marker animals in their projects. A couple rounds of breeding marker carrying het pieds and you have enriched for the marker trait in offspring of pied breedings in the same manner that you have enriched for high yellow animals in pastel breedings.
Granted, I could be wrong. More than happy to admit that. All I am trying to do is offer and argument that many people seem to be ignoring as a possibility.
Good point, i never thought of it in those terms before. I guess that kind of logic is applied to breeding any animals to achieve a certain 'affect.' Not that they're the same but i know the bichon dogs were bred specifically to wave, so that breed to known for their waving. Rats can be bred for personality and color or physical differences in either dom or rec genes. I never thought of applying that same type of thought into herp genes. Makes sence, but again as we have already learned (or as i have learned) none of those are 100% accurate within any species. I guess the markers make for a good basis but it ultimately comes down to the breeder and their knowlege of past clutches to determine the outcome of the latest clutch and genetic differences within those offspring alone, not necessarily all offspring of every clutch ever produced by anyone in anyplace. (if that makes sense)
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|