» Site Navigation
2 members and 687 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,118
Posts: 2,572,192
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by WingedWolfPsion
Interesting article on ANDi there... When I talked to Anthony years ago he told me ANDi did fluoresce... wonder if that was before or after that article was out...
You do NOT have to know the entire genome of an animal in order to introduce GFP genes.
I did not say you HAD to have it I just said it would make the process easier if you were looking to insert it at a specific loci. Like if you wanted just the alien heads to fluoresce...
Genetic engineering is much messier than you realize.
I am sorry, I hate to sound arrogant but I hold a PhD in molecular genetics. I realize full well how messy genetic engineering can be (and for the most part is.) However, I also realize that, with the advent of modern and next-gen sequencing and refined techniques, it need not be as messy. Synthetic biology is not that that far away and not nearly as messy.
And all you really need is a freshly laid ball python egg, and a male and female ball python, to get started. (And a lot of money and special equipment).
I think it might take a bit more than that. I could well be mistaken but I think you would need to hit the egg much earlier on, while it was still in the mother. But I could be mistaken on that. I have not seen any work on TG animals that retain their eggs for a period after fertilization, that may complicate the matter some.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by asplundii;924641I did not say you HAD to have it I just said it would make the process easier if you were looking to insert it at a specific loci. Like if you wanted just the alien heads to fluoresce...
I am sorry, I hate to sound arrogant but I hold a PhD in molecular genetics. :) I realize full well how messy genetic engineering [I
can[/I] be (and for the most part is.) However, I also realize that, with the advent of modern and next-gen sequencing and refined techniques, it need not be as messy. Synthetic biology is not that that far away and not nearly as messy.
Arrogance is allowed--I did think you were saying it was necessary to map out the genome first. I do have doubts that cutting-edge tech will be applied to develop these ball pythons, as they implied they were already working on it.
-
-
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by WingedWolfPsion
Arrogance is allowed--
That may be but it is not exactly what I was getting at 
I was more trying to say: "I know that bringing up the fact that I hold a PhD is going to sound arrogant but that is not my intent. I just want to explain that I do have an understanding of what is being talked about because it is something I have first hand experience with."
Not: "All worship me, I have a PhD!!"
Does that make sense?
I did think you were saying it was necessary to map out the genome first.
Yes, going back and reading over it my intent was not as clear as I thought I was. My apologies on that.
I do have doubts that cutting-edge tech will be applied to develop these ball pythons, as they implied they were already working on it.
Undoubtedly you are right that any work being done currently is more than likely to be crash and bash style knock-ins. Which means that any glo-balls put out by this group will likely express full body glow. And why you would use a ball for that experiment I do not know as I would think there are plenty of other smaller, faster maturing snakes you could iron out the methodologies on. But hey, it isn't my money/time so...
Personally, if I were going to do it I would go with next-gen technologies. Sequence the genome, find the pattern specific expression genes and work my inserts there. I think a snake expressing the fluorescence in a patter dependent manner would beat one that has the glow wash over its whole body. But maybe that is just me...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|