Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 4,745

0 members and 4,745 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,112
Threads: 249,262
Posts: 2,573,031
Top Poster: JLC (31,651)
Welcome to our newest member, Adele King
Page 6 of 6 FirstFirst 123456
Results 51 to 53 of 53
  1. #51
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Fluorescent ball pythons...I kid you not.

    Quote Originally Posted by WingedWolfPsion View Post

    Possible failed fluorescent monkey: http://www.genomenewsnetwork.org/art..._01/ANDi.shtml (He carries the genes, but doesn't fluoresce yet).
    Interesting article on ANDi there... When I talked to Anthony years ago he told me ANDi did fluoresce... wonder if that was before or after that article was out...

    You do NOT have to know the entire genome of an animal in order to introduce GFP genes.
    I did not say you HAD to have it I just said it would make the process easier if you were looking to insert it at a specific loci. Like if you wanted just the alien heads to fluoresce...

    Genetic engineering is much messier than you realize.
    I am sorry, I hate to sound arrogant but I hold a PhD in molecular genetics. I realize full well how messy genetic engineering can be (and for the most part is.) However, I also realize that, with the advent of modern and next-gen sequencing and refined techniques, it need not be as messy. Synthetic biology is not that that far away and not nearly as messy.

    And all you really need is a freshly laid ball python egg, and a male and female ball python, to get started. (And a lot of money and special equipment).
    I think it might take a bit more than that. I could well be mistaken but I think you would need to hit the egg much earlier on, while it was still in the mother. But I could be mistaken on that. I have not seen any work on TG animals that retain their eggs for a period after fertilization, that may complicate the matter some.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #52
    BPnet Senior Member WingedWolfPsion's Avatar
    Join Date
    09-27-2007
    Location
    Plattsmouth, NE
    Posts
    5,168
    Thanks
    124
    Thanked 1,785 Times in 1,134 Posts
    Images: 1

    Re: Fluorescent ball pythons...I kid you not.

    Quote Originally Posted by asplundii;924641I did not say you HAD to have it I just said it would make the process easier if you were looking to insert it at a specific loci. Like if you wanted just the alien heads to fluoresce...

    I am sorry, I hate to sound arrogant but I hold a PhD in molecular genetics. :) I realize full well how messy genetic engineering [I
    can[/I] be (and for the most part is.) However, I also realize that, with the advent of modern and next-gen sequencing and refined techniques, it need not be as messy. Synthetic biology is not that that far away and not nearly as messy.
    Arrogance is allowed--I did think you were saying it was necessary to map out the genome first. I do have doubts that cutting-edge tech will be applied to develop these ball pythons, as they implied they were already working on it.
    --Donna Fernstrom
    16.29 BPs in collection, 16.11 BP hatchlings
    Eclipse Exotics
    http://www.eclipseexotics.com/
    Author Website
    http://donnafernstrom.com
    Follow my Twitters: WingedWolfPsion, EclipseMeta, and EclipseExotics

  3. #53
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Fluorescent ball pythons...I kid you not.

    Quote Originally Posted by WingedWolfPsion View Post
    Arrogance is allowed--
    That may be but it is not exactly what I was getting at

    I was more trying to say: "I know that bringing up the fact that I hold a PhD is going to sound arrogant but that is not my intent. I just want to explain that I do have an understanding of what is being talked about because it is something I have first hand experience with."

    Not: "All worship me, I have a PhD!!"

    Does that make sense?

    I did think you were saying it was necessary to map out the genome first.
    Yes, going back and reading over it my intent was not as clear as I thought I was. My apologies on that.

    I do have doubts that cutting-edge tech will be applied to develop these ball pythons, as they implied they were already working on it.
    Undoubtedly you are right that any work being done currently is more than likely to be crash and bash style knock-ins. Which means that any glo-balls put out by this group will likely express full body glow. And why you would use a ball for that experiment I do not know as I would think there are plenty of other smaller, faster maturing snakes you could iron out the methodologies on. But hey, it isn't my money/time so...

    Personally, if I were going to do it I would go with next-gen technologies. Sequence the genome, find the pattern specific expression genes and work my inserts there. I think a snake expressing the fluorescence in a patter dependent manner would beat one that has the glow wash over its whole body. But maybe that is just me...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 6 of 6 FirstFirst 123456

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1