» Site Navigation
1 members and 1,912 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,104
Threads: 249,252
Posts: 2,572,973
Top Poster: JLC (31,651)
|
-
Question on the use of the term "incompatible"
How exactly are breeders using the term "incompatible" in reference to specific lines? As a geneticist I know of two uses for it.
So, in terms of ball morphs just to keep it simple I will use the VPI axanthic and Jolliff axanthic lines.
Both are phenotypic axanthic
So, if I cross a VPI to a Jolliff do I get:
1) A bunch of normal looking offspring (that are in essence double het for both VPI and Jolliff.)? In this case incompatible would mean that the two lines are likely distinct genetic loci so even though there are 2 copies of an axanthic-type gene in each of the offspring the offspring are normal appearing because the 2 axanthic-type genes are are at different locations and therefore each is complimented by the normal WT copy at the same location.
2) No viable offspring? In this case incompatible would quite literally mean the 2 different mutations are not compatible when present in the same animal as single copies leading to the death of the offspring
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Question on the use of the term "incompatible"
I'm pretty sure it is used in terms of #1.
-
-
Re: Question on the use of the term "incompatible"
There are no ball pythons traits that when combined have been proven an always fatal combination... to my knowledge.
The answer is #1
Justin
-
-
BPnet Veteran
Re: Question on the use of the term "incompatible"
 Originally Posted by jkobylka
There are no ball pythons traits that when combined have been proven an always fatal combination... to my knowledge.
The answer is #1
Justin
actually theres a combination with woma thats always fatal i forget the name tho
Reptiles make life tolerable.
Jeremiah Elleman[FONT="Comic Sans MS"][/FO
-
-
Re: Question on the use of the term "incompatible"
 Originally Posted by jere000
actually theres a combination with woma thats always fatal i forget the name tho
I think you may be thinking of the Pearl. But its the Homozygous from of the woma and not a combo.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
The Following User Says Thank You to Freakie_frog For This Useful Post:
-
Re: Question on the use of the term "incompatible"
Thank you all. I suspected #1 to be the case but I had not heard anything explicit on the matter and was just curious.
So, tangent, has anyone ever tried for a double homozygous VPI/Jolliff (or VPI/TSK or Jolliff/TSK)? I'd think maybe a double axanthic might hold its colour better over time...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Question on the use of the term "incompatible"
 Originally Posted by asplundii
Thank you all. I suspected #1 to be the case but I had not heard anything explicit on the matter and was just curious.
So, tangent, has anyone ever tried for a double homozygous VPI/Jolliff (or VPI/TSK or Jolliff/TSK)? I'd think maybe a double axanthic might hold its colour better over time...
Mike Jolliff (originator of the Jolliff line Axanthic) did breed VPI line to Jolliff line years ago, and proved the incompatibility. However, I do not know if Mikie ever tried to produce the Homozygous combination). I do not know of anyone that has bred DH x DH, to see the outcome of the Double Homozygous animal.
I hope that helps,
-
-
Re: Question on the use of the term "incompatible"
Hey Tim,
Thanks for the info. Not a huge deal to me if it has happened or not, was just a moment of curiosity.
Cheers
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|