Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 717

0 members and 717 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,110
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 16

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Parthenogenesis?

    Quote Originally Posted by NicoleG View Post
    I just want to clarify… if mom is a YB, will the babies all be YBs, or Super YBs?
    Incorrect.

    If mom is a YB and goes partho then she will produce only normals and Ivories. You will not get YBs from a partho clutch
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Armiyana (08-10-2023),Bogertophis (08-09-2023),Homebody (08-11-2023)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1