Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 671

0 members and 671 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,121
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17
  1. #11
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New addition- Tioman Island Kukri Snake

    This is her during a feeding session. I'm happy to say that she's an excellent feeder, and scenting the pink with egg isn't even necessary.

    Sent from my SM-G970U using Tapatalk

  2. The Following 2 Users Say Thank You to Awesomethepossum For This Useful Post:

    Bogertophis (10-29-2020),Reinz (10-30-2020)

  3. #12
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New addition- Tioman Island Kukri Snake

    Quote Originally Posted by Reinz View Post
    Very interesting snakes!

    ‘When I first read your title I immediately thought of the Kukri/khurkuri knives originating from the Gurkhas Indians.

    I hope that she will easily take rodents, unless you have a reliable source for frogs and lizards.

    Please post more about her progression.
    I made sure she was established on rodents before moving forward with the purchase. The seller holds back his poorer feeders, but I was (am) also prepared if food refusals became an issue. The seller said quail eggs will fix this if that was the case, I know they feed on eggs in the wild.

    She was feeding on pinks from the get-go. That in mind, I keep fresh quail eggs in the house, and offer her a cracked egg overnight on feeding days. But she hasn't refused a meal yet.

    I've been looking into frog as another source as well. I've heard of someone offering frog legs to their kukri, I'll have to look more into that. But I'm very excited to be working with this species, I've been wanting to get one for some time now.

    Sent from my SM-G970U using Tapatalk

  4. The Following 2 Users Say Thank You to Awesomethepossum For This Useful Post:

    Bogertophis (10-29-2020),Reinz (10-30-2020)

  5. #13
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New addition- Tioman Island Kukri Snake

    I apologize for any misunderstanding here, I always add "any advice, insight, experience is appreciated" to my posts. I didn't mean to imply that I don't do my own research or planning

    I always do my own research prior to getting an animal, and plan everything ahead of time. I just keep myself open to discussion, and to different information sources. It's just nice to hear from others who might also own the species, or others who may have learned something about them that they're willing to share. It leads to interesting discussion. Sorry about that.

    Sent from my SM-G970U using Tapatalk
    Last edited by Awesomethepossum; 10-29-2020 at 12:45 PM.

  6. The Following User Says Thank You to Awesomethepossum For This Useful Post:

    Bogertophis (10-29-2020)

  7. #14
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,791
    Thanks
    29,349
    Thanked 20,564 Times in 12,289 Posts
    Great updates! I love good feeders & she's so pretty & unusual (rare).
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  8. The Following User Says Thank You to Bogertophis For This Useful Post:

    Awesomethepossum (10-30-2020)

  9. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New addition- Tioman Island Kukri Snake

    Quote Originally Posted by AzJohn View Post
    but you can feed them bird eggs as well. The eggs will need to be cracked open. The teeth are designed to slice, not puncture, so they won’t be able to open hard shelled bird eggs.
    This is not entirely accurate, the adults are more than capable of puncturing a quail egg.


    These animals are highly fossorial so use a media that is very loose and fairly deep because they love to dig down. Also, provide plenty of hiding places - cork tubes, cork flats and the like. I keep in naturalistic setups and use a variety of creeping ivy plants and a huge amount of leaf litter as well.

    They do not like high temps, try to avoid going above 30C. They prefer a higher humidity and will shed poorly if too dry. I run a 12/12 light cycle year round

    I feed a diet heavy on quail eggs. As I noted above, the adults are more than capable of popping their own, but since I have a cutter and am cutting for younger ones I just cut all of them. I feed one egg every 10-14 days, a bit more frequently for younger ones. About every third feed I insert a ReptiLink micro link into the egg, sort of a "false embryo" thing, adds some extra nutrition and trace elements and such. I will also rotate in button quail chicks and fish filet segments of appropriate size.

    As mentioned, their teeth are no joke. Even small animals can do a lot of damage. Their defensive bite behaviour is to bite and twist, tends to leave a sort of spiral cut. The wounds bleed profusely, it is suspected that they have an anti-coagulant in their saliva

    They are very secretive animals and do not do well when stressed. Best habit is to set them and forget them
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Awesomethepossum (10-30-2020),Bogertophis (10-30-2020),Reinz (10-30-2020)

  11. #16
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New addition- Tioman Island Kukri Snake

    Quote Originally Posted by asplundii View Post
    This is not entirely accurate, the adults are more than capable of puncturing a quail egg.


    These animals are highly fossorial so use a media that is very loose and fairly deep because they love to dig down. Also, provide plenty of hiding places - cork tubes, cork flats and the like. I keep in naturalistic setups and use a variety of creeping ivy plants and a huge amount of leaf litter as well.

    They do not like high temps, try to avoid going above 30C. They prefer a higher humidity and will shed poorly if too dry. I run a 12/12 light cycle year round

    I feed a diet heavy on quail eggs. As I noted above, the adults are more than capable of popping their own, but since I have a cutter and am cutting for younger ones I just cut all of them. I feed one egg every 10-14 days, a bit more frequently for younger ones. About every third feed I insert a ReptiLink micro link into the egg, sort of a "false embryo" thing, adds some extra nutrition and trace elements and such. I will also rotate in button quail chicks and fish filet segments of appropriate size.

    As mentioned, their teeth are no joke. Even small animals can do a lot of damage. Their defensive bite behaviour is to bite and twist, tends to leave a sort of spiral cut. The wounds bleed profusely, it is suspected that they have an anti-coagulant in their saliva

    They are very secretive animals and do not do well when stressed. Best habit is to set them and forget them
    Thank you very much for all this information!

    She's in a 12qt tub right now- she's a little over a month old. The substrate is 2 1/2- 3 inches deep, a mix of mosses and reptichip for the time being, and 1/4 of it has paper towel, where I offer the quail eggs and a small water dish. I have coco fiber and organic potting soil on hand as well.

    The seller told me they can die from poor sheds, so I have the humidity between 75- 85% right now, I based it off of Thailand's averages. Her temps in the enclosure range from 75- 83F cool to warm end, the room is maintained at a minimum of 75F with a small ECO heater. I keep her enclosure near my bearded dragon's setup, so she recieves the day/night light cycle as well. But I'll be sure to keep the temp below 86.

    I was told to feed her every 2-4 days at this age. I'm uncertain how rapidly they grow, but of course I'll space feedings accordingly as she matures. I heard 10-14 days for adults as well, so I'm glad you could verify that for me.

    I would like to provide her with as diverse a diet as possible to make sure all her nutritional requirements are met- mimic her natural diet as much as possible. The "false embryo" idea is very clever and I'll definitely be incorporating that.

    I'm uncertain as to how large her adult enclosure should be (at minimum), but I'm sure they use all the space they're provided. It would be nice to have a bioactive setup going for her eventually. I havent done one before, but my goal is to reduce as much stress and unnecessary contact as possible.

    I'm happy to hear from someone who has owned them for a while (and everyone else and their kind/encouraging words, of course!) , I greatly appreciate all this information.

    Sent from my SM-G970U using Tapatalk
    Last edited by Awesomethepossum; 10-30-2020 at 10:52 AM.

  12. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New addition- Tioman Island Kukri Snake

    Quote Originally Posted by Awesomethepossum View Post
    I'm uncertain as to how large her adult enclosure should be (at minimum), but I'm sure they use all the space they're provided.
    My adults are in cages with a 60cm x 60cm footprint and is 30cm tall (being as fossorial as they are, they care little for height). I am sure they would make use of more space if it were available but they seem happy with what they have
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following User Says Thank You to asplundii For This Useful Post:

    Awesomethepossum (11-02-2020)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1