Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 678

0 members and 678 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,229
Posts: 2,572,847
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Results 1 to 5 of 5

Thread: Bredlis pythons

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The "Affors" line tend to have less black to them and be a bit brighter red, the "poor man's Hypo" if you will. There are a few other breeders out there that have selectively bred for redder animals but you will be paying a bit more for the time they have put into the project that you would for a regular animal.

    Casey and Nick are both great sources for bredli, I have an animal from each of them.

    Owen McIntyre of Rogue Reptiles/Morelia Python Radio podcast is also a great source. I do not have any animals from him but I have seen his breeders and they are top quality
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    jmcrook (07-06-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1