Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,040

1 members and 2,039 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,107
Threads: 249,255
Posts: 2,572,997
Top Poster: JLC (31,651)
Welcome to our newest member, cheeseburger
Results 1 to 10 of 67

Threaded View

  1. #21
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If you can find them, rubber boas would be great in a 40g. Added bonus with them is that they do not require supplemental heating and thrive a room conditions. They are difficult to track down however

    Another option I did not see (granted, I did power skim so I might have missed it) would be sand boas
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    vivi (04-13-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1