Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,054

1 members and 1,053 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,947
Threads: 249,146
Posts: 2,572,383
Top Poster: JLC (31,651)
Welcome to our newest member, featheredhs
Results 1 to 10 of 12

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Finally got some acid!

    Welcome to the club

    Quote Originally Posted by rufretic View Post
    Most agree acid/static/confusion are the same morph.
    Small clarification; most of us working with Acid/Confusion/Static think that they are most likely allelic but not identical. Kind of along the lines of BlkPastel/Cinny/HRA - the differences are fairly subtle in the single gene form, but in combos it starts to become more obvious
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Godzilla78 (02-13-2020),JoeNapoli (08-30-2021),rufretic (02-11-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1