» Site Navigation
1 members and 667 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,105
Posts: 2,572,113
Top Poster: JLC (31,651)
|
-
Spider Ball Python ban and breeding
I am aware of the controversy surrounding spider ball pythons and the ethical issue of breeding these snakes when they have a neurological issue such as the spider wobble. I am writing a paper on the issue and I just want to see everyone's opinion on the issue and why they believe in that opinion. I hope my paper sheds some light on this issue in the ball python community. :)
-
The Following User Says Thank You to tickyyy For This Useful Post:
Craiga 01453 (12-11-2019)
-
Re: Spider Ball Python ban and breeding
 Originally Posted by tickyyy
I am aware of the controversy surrounding spider ball pythons and the ethical issue of breeding these snakes when they have a neurological issue such as the spider wobble. I am writing a paper on the issue and I just want to see everyone's opinion on the issue and why they believe in that opinion. I hope my paper sheds some light on this issue in the ball python community. 
Sooooooo I used to have a stunning Caramel Albino Spider and it had ZERO wobble !!
Interestingly it was THE best feeder I’ve ever had !!
Sent from my iPhone using Tapatalk Pro
-
-
Re: Spider Ball Python ban and breeding
 Originally Posted by Zincubus
Sooooooo I used to have a stunning Caramel Albino Spider and it had ZERO wobble !!
Interestingly it was THE best feeder I’ve ever had !!
Sent from my iPhone using Tapatalk Pro

Sent from my iPhone using Tapatalk Pro
-
The Following User Says Thank You to Zincubus For This Useful Post:
-
Speaking as a scientist (broadly) and a geneticist (specifically) my opinion is that:
1) All Spiders (and affiliated morphs) have the issue to some degree. There are none that are completely free of it.
2) The root of the controversy is being generated by people with little to no actual scientific background making assertions based off of anthropomorphized generalizations and personal feelings
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 10 Users Say Thank You to asplundii For This Useful Post:
Craiga 01453 (12-11-2019),ladywhipple02 (12-11-2019),MattEvans (12-11-2019),mdb730 (12-11-2019),paulh (12-11-2019),PghBall (12-12-2019),PitOnTheProwl (12-11-2019),Stewart_Reptiles (12-11-2019),tickyyy (12-11-2019),Toad37 (12-11-2019)
-
Re: Spider Ball Python ban and breeding
 Originally Posted by asplundii
2) The root of the controversy is being generated by people with little to no actual scientific background making assertions based off of anthropomorphized generalizations and personal feelings
Haven't logged in in awhile, been lurking as a guest here and there, but it's been super busy lately. However, I felt compelled to log in simply to "like" this comment. Cheers to that!
-
The Following User Says Thank You to ladywhipple02 For This Useful Post:
-
Too many people say their spider/combo doesn't wobble....
Too many people say they shouldn't be bred....
Both are blind to the other.
Very few are open minded.
Having several spider genes in my collection, they are some of the best feeders I have and were the easiest to switch to FT.
BTW there are more morphs that wobble...
-
The Following User Says Thank You to PitOnTheProwl For This Useful Post:
Craiga 01453 (12-11-2019)
-
Re: Spider Ball Python ban and breeding
This may be unpopular opinion judging by responses so far, but I am personally against the breeding of spiders and I think it's right to ban them. Even with spiders that don't exhibit severe symptoms, we are only able to judge the effects of the wobble by behaviour we can observe and since (as far as I am aware) there have never been studies on if spiders have elevated stress levels and other relevant factors, and snakes are not very expressive, we can't know if they are suffering or not, and how much, if they are.
This aside, knowingly producing animals that may not be able to feed or move normally seems unfair to me. Even if it is just one out of many snakes that will experience symptoms that severe, that is still a living creature that was brought into the world to suffer needlessly by choice. And before anyone brings up this argument, yes, I feel the same way about dog and cat breeds that are known to have health-jeopardizing defects like pugs and Scottish folds, and about any other animals that are bred as pets despite known health problems.
With that said, I can also understand why people like spiders and find them desirable. They are beautiful. One of the first BP morphs I ever saw was a banana spider, and I think it is still one of the most beautiful BPs I've ever seen. I won't hold my opinions against anyone who owns spiders, but I would personally never get one or support breeding them.
-
The Following User Says Thank You to Luvyna For This Useful Post:
-
The bashing spider movement is from people who generally know nothing, never owned a spider, never bred them but heard from someone who heard from someone who watch a video once . Sure they wobble to a degree however train wrecks are rare, in most cases it will be hardly noticeable at all and if kept properly a Spider will thrive and do exactly the same things any other BP with any other paint job will do.
Ironically Spiders are the focus of the bashing when other mutations who exhibit the same issue are left alone if people wanted to be fair their would bash those other mutations as well.
Another irony most people that you will find against the spider gene have no issue with some dogs such as bulldogs, chihuahuas to name a few who have health issues and rarely can give birth naturally.
It's simple you like spider own them, you don't like them don't own them, but saying something should be ban is a slippery slope to ban anything and everything all together because one person disagrees with it.
The majority of breeders are ethical and care and will cull anything that will not have quality of life, in the years I used to work with spiders (I no longer do since I focus on Pied now) I have never had to cull a spider I have however had to cull other animals however that would not have thrive or have a quality of life......that comes with breeding.
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
Registered User
I have one, and even after months of proper care, she still wobbles. :| I don't know why so many breeders act as if the wobble isn't an issue. When we changed my girl's substrate, it was ridiculous. She was flailing, arching every which way, ect. She's not the only rescue bp in this house, but she's the only spider rescue and the only one to have such a worrying reaction. Despite being rescued from similar conditions.
-
-
Registered User
Re: Spider Ball Python ban and breeding
 Originally Posted by Phantomfugue
I have one, and even after months of proper care, she still wobbles. :| I don't know why so many breeders act as if the wobble isn't an issue. When we changed my girl's substrate, it was ridiculous. She was flailing, arching every which way, ect. She's not the only rescue bp in this house, but she's the only spider rescue and the only one to have such a worrying reaction. Despite being rescued from similar conditions.
Rescues are in need of rescuing because of the poor condition of the husbandry and animal. Poor husbandry such as too much heat will cause further damage making the symptoms worse. So yeah if the person you got him from or yourself were'nt using a thermostat to control the heat i could see that causing permanent damage. Add 10° f to the average human body temperature and it causes brain damage.
Last edited by MattEvans; 12-11-2019 at 03:50 PM.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|