Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 821

1 members and 820 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,903
Threads: 249,097
Posts: 2,572,069
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 10 of 31

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Speaking as a scientist (broadly) and a geneticist (specifically) my opinion is that:

    1) All Spiders (and affiliated morphs) have the issue to some degree. There are none that are completely free of it.

    2) The root of the controversy is being generated by people with little to no actual scientific background making assertions based off of anthropomorphized generalizations and personal feelings
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 10 Users Say Thank You to asplundii For This Useful Post:

    Craiga 01453 (12-11-2019),ladywhipple02 (12-11-2019),MattEvans (12-11-2019),mdb730 (12-11-2019),paulh (12-11-2019),PghBall (12-12-2019),PitOnTheProwl (12-11-2019),Stewart_Reptiles (12-11-2019),tickyyy (12-11-2019),Toad37 (12-11-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1