» Site Navigation
0 members and 752 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,104
Posts: 2,572,101
Top Poster: JLC (31,651)
|
-
Re: AP cage
 Originally Posted by Neal
Dang, their lead times are this far out? Holy, I thought they had another setup being ran to cut lead times down.
I placed my order on 24 June so I am now at 23 weeks and I still have not received even an update from them.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
AP usually don't send out updates, normally all you hear once you place your order is the eventual tracking info.
If you want an update, you need to contact then, phone is the best way, Ali has always been very helpful and responsive when I've called before.
-
-
Re: AP cage
 Originally Posted by bhsurf4
I got a text from FedEx saying I had a delivery coming Friday. I couldn’t remember ordering anything and I thought maybe I went on a drunk amazon bender. Then I got another text and realized it was the AP cage I ordered July 10th! Guess my (not so small anymore) retic is getting to move into his new digs this weekend! Then I can move my boa into his old cage and one of my bigger female BP’s will get an upgrade too. Now that I’m typing this, is sure sounds like a lot of work!!
Fun work though cause once you're set up and everyone gets their upgrades, you get to enjoy it!
-
-
Re: AP cage
 Originally Posted by asplundii
I placed my order on 24 June so I am now at 23 weeks and I still have not received even an update from them.
As stated call them. Or contact them from here:
https://apcages.com/pages/contact-us
I used the contact page an two days later was e-mailed it will ship in two days.
Last edited by 303_enfield; 11-29-2019 at 08:56 PM.
-
-
Registered User
Re: AP cage
 Originally Posted by 303_enfield
303 enfield? Love the username!!
Sent from my iPhone using Tapatalk
-
-
Registered User
Re: AP cage
So what are other faster options with ap having these crazy wait times?
Sent from my iPhone using Tapatalk
-
-
Registered User
Re: AP cage
 Originally Posted by Solidsnek
So what are other faster options with ap having these crazy wait times?
Sent from my iPhone using Tapatalk
Build? I ordered an AP enclosure 4+ months ago. I have since built another enclosure (for different snakes). I am still waiting on my AP enclosure.
-
The Following User Says Thank You to Alien For This Useful Post:
-
Registered User
Re: AP cage
 Originally Posted by Alien
Build? I ordered an AP enclosure 4+ months ago. I have since built another enclosure (for different snakes). I am still waiting on my AP enclosure.
So I can and do build fpv drones, so I’m not useless,
However with this type of thing, I feel it’s safest to buy haha. I also have zero tools required for this style project
-
-
Registered User
Re: AP cage
 Originally Posted by Solidsnek
So I can and do build fpv drones, so I’m not useless,
However with this type of thing, I feel it’s safest to buy haha. I also have zero tools required for this style project
Any friends that can help?
-
-
Re: AP cage
 Originally Posted by Solidsnek
So what are other faster options with ap having these crazy wait times?
Sent from my iPhone using Tapatalk
I'm very happy with my Reptile Basics cages. Even with COVID-19 shipping delays, they are predicting delivery in 6-7 weeks. Prior to COVID-19, my cages were delivered in 4 weeks.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|