Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,808

0 members and 1,808 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,069
Threads: 249,219
Posts: 2,572,797
Top Poster: JLC (31,651)
Welcome to our newest member, ColorblindChameleon
Page 2 of 2 FirstFirst 12
Results 11 to 15 of 15

Thread: New egg-eater

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New egg-eater

    Quote Originally Posted by Gocntry View Post
    Lots of Good Info, Thanks!

    Now a couple questions if you don't mind...
    Not a problem, always happy to help where I can.


    Quote Originally Posted by Gocntry View Post
    The local breeder near me has "Dasypeltis gansi " would the same basic rules apply to these as well??
    I would apply what I wrote above to any of the Dasypeltis species. For some, like D. scabra, I might add a couple extra ground hides because they occasionally lean a little more toward the "semi-" side of semi-arboreal but, in my experience, when given the option to go vertical they will make full use of it


    Quote Originally Posted by Gocntry View Post
    These type of snakes can be Cohabited correct? (it's what I was told)
    Yes, they can cohabit. My only advise would be to make sure you have enough space and hides to give both (all) animals a place to "escape" to and to make sure that one animal is not bullying the other(s) away from food. I would also caution, if you have a 1.1 pair, that these snakes breed easily so you will need to be ready for babies which means either having ready access to finch eggs or being willing AND able to syringe feed (remember what I said above about their delicate spines and then think about trying to get a ball-end syringe into the mouth of an animal the size of an earthworm.)


    Quote Originally Posted by Gocntry View Post
    When getting eggs from a local market, using refrigerated eggs and bringing them up to room temps before feeding works ok?

    Or do you need fresh eggs?
    Just pull them from the fridge and let them come up to room temp. If you are worried about the eggs being good as you approach the egg of the carton then you can fill a glass with water and drop the egg in. If it floats then it is/is going bad


    Quote Originally Posted by Gocntry View Post
    And from August to February feeding is withheld? Wow, long time no eating.. of course with the stories of peoples BP's not eating I'm just not used to not feeding animals for that long.
    It does seem like a long time but this is how these animals evolved. Think about the seasonal cycle where they live; in spring all the birds are roosting/nesting, by late spring/early summer they are laying their eggs and by the end of summer the chicks will have hatched and by autumn/winter there are no eggs. So the snakes are conditioned to glut in the time of plenty and then live off their reserves during the time of famine.




    Quote Originally Posted by Awesomethepossum View Post
    I'm really glad you saw this post then- and I'm also glad I posted here. I've been getting a lot of different info, but obviously I want to do what's best for my snake. So whatever info or advice you have, I'll happily accept/take.
    I will interject a small caveat here... I came up with how I keep these snakes based on my own research into them using articles and looking at their habitat and such. It was years later that I found the egg-eater FaceBook group and discovered that I was pretty much the only person who keeps them this way. It is possible to keep them as a more "traditional" colubrid but my goal was always to try and emulate their natural environment as best as possible. So you can take my advice or leave it as you see fit.


    Quote Originally Posted by Awesomethepossum View Post
    Do these pictures work?
    Honestly... Not really LOL. The flash is washing out the markings on the head I was looking for for confirmation and your thumb is covering up a bunch of the scales on the tail so I cannot get a good count

    That said, I still feel pretty good on my ID of medici and, unless you plan on trying to breed, the sex of the animal is pretty irrelevant. Your animal is a good looking animal and at the end of the day that is the most important part


    Quote Originally Posted by Awesomethepossum View Post
    Poor thing was really flustered that I dug it out to take these pictures. Has been digging around and tunneling, which I thought was strange..
    Probably looking for a place to hide, they can be flighty if they feel insecure


    Quote Originally Posted by Awesomethepossum View Post
    So you think it's female? She is pretty large, but I didn't have any information to refer to...
    The size makes me thing female. There is a definite dimorphism in this genus


    Quote Originally Posted by Awesomethepossum View Post
    I left two different types of quail eggs in the tub. All fresh. So far, she's shown no interest, but if what you say is true than that would make sense.
    From these pics your animal is perfectly healthy bordering on being a little chubby so I would not stress if it is not eating right now. Get it a good hab, let it settle in, keep water available, and then in a month or two you can offer an egg. Or you can just wait until March to start cycle feeding


    Quote Originally Posted by Awesomethepossum View Post
    This is why I'm confused, because the seller said the guy who owned this snake was giving one egg a week
    As I said above, people have been keeping these snakes like traditional colubrids for years and had success. If you are more comfortable keeping them that way then you are welcome to. I am definitely not saying that my way is the only way to keep them, it is simply the only way I will keep them
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    aurum (11-15-2019),Awesomethepossum (11-15-2019),Bogertophis (11-15-2019),Gocntry (11-16-2019)

  3. #12
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New egg-eater

    Quote Originally Posted by asplundii View Post

    I would apply what I wrote above to any of the Dasypeltis species. For some, like D. scabra, I might add a couple extra ground hides because they occasionally lean a little more toward the "semi-" side of semi-arboreal but, in my experience, when given the option to go vertical they will make full use of it


    I will interject a small caveat here... I came up with how I keep these snakes based on my own research into them using articles and looking at their habitat and such. It was years later that I found the egg-eater FaceBook group and discovered that I was pretty much the only person who keeps them this way. It is possible to keep them as a more "traditional" colubrid but my goal was always to try and emulate their natural environment as best as possible. So you can take my advice or leave it as you see fit.


    Honestly... Not really LOL. The flash is washing out the markings on the head I was looking for for confirmation and your thumb is covering up a bunch of the scales on the tail so I cannot get a good count

    That said, I still feel pretty good on my ID of medici and, unless you plan on trying to breed, the sex of the animal is pretty irrelevant. Your animal is a good looking animal and at the end of the day that is the most important part

    The size makes me thing female. There is a definite dimorphism in this genus

    From these pics your animal is perfectly healthy bordering on being a little chubby so I would not stress if it is not eating right now. Get it a good hab, let it settle in, keep water available, and then in a month or two you can offer an egg. Or you can just wait until March to start cycle feeding

    As I said above, people have been keeping these snakes like traditional colubrids for years and had success. If you are more comfortable keeping them that way then you are welcome to. I am definitely not saying that my way is the only way to keep them, it is simply the only way I will keep them
    I apologize for the picture quality- my home is poorly-lit and it was pretty late That and she was pissed...

    I'm comfortable with your thoughts on it being female. I don't plan to breed, I just like knowing the sexes of my pets.

    I did request to join the facebook egg eater group a few days ago but havent heard back yet.

    In your experience, do you happen to have an idea of the longevity of these snakes? And would it be possible to see a picture of your setup?

    1.0 Pumpkin Pied BP, 0.1 KSB, 0.1 Bearded dragon, 1.2 Leopard gecko, 0.1 Ornate Pacman Frog, 1.1 Barred tiger salamander
    Last edited by Awesomethepossum; 11-15-2019 at 12:29 PM.

  4. #13
    BPnet Veteran Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    744
    Thanks
    482
    Thanked 991 Times in 475 Posts

    Re: New egg-eater

    Quote Originally Posted by asplundii View Post
    It does seem like a long time but this is how these animals evolved. Think about the seasonal cycle where they live; in spring all the birds are roosting/nesting, by late spring/early summer they are laying their eggs and by the end of summer the chicks will have hatched and by autumn/winter there are no eggs. So the snakes are conditioned to glut in the time of plenty and then live off their reserves during the time of famine.
    So True, That's the "outside the box" thinking I need to learn to do more of!!

    Thanks for all the info!

  5. #14
    BPnet Veteran Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    744
    Thanks
    482
    Thanked 991 Times in 475 Posts

    Re: New egg-eater

    Quote Originally Posted by Awesomethepossum View Post
    and she was pissed...
    So Egg Eaters can throw some attitude? Good to know

  6. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New egg-eater

    Quote Originally Posted by Awesomethepossum View Post
    I apologize for the picture quality- my home is poorly-lit and it was pretty late That and she was pissed...
    I did not mean my comment to come of as a harsh criticism. I was not chastising you


    Quote Originally Posted by Awesomethepossum View Post
    I'm comfortable with your thoughts on it being female. I don't plan to breed, I just like knowing the sexes of my pets.

    I did request to join the facebook egg eater group a few days ago but havent heard back yet.
    The Admin of the group can be a little slow to reply.


    Quote Originally Posted by Awesomethepossum View Post
    In your experience, do you happen to have an idea of the longevity of these snakes? And would it be possible to see a picture of your setup?
    No clue what longevity is. My oldest was acquired as an adult and I have had her for eight years so far so I figure 10-12 is a safe bet



    Quote Originally Posted by Gocntry View Post
    So True, That's the "outside the box" thinking I need to learn to do more of!!

    Thanks for all the info!
    Happy to help


    Quote Originally Posted by Gocntry View Post
    So Egg Eaters can throw some attitude? Good to know
    It is all an act. But they sure can throw a great threat display when they are in the mood
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Awesomethepossum (11-18-2019),Gocntry (11-19-2019)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1