Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 618

0 members and 618 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 10 of 15

Thread: New egg-eater

Threaded View

  1. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New egg-eater

    Quote Originally Posted by Awesomethepossum View Post
    I apologize for the picture quality- my home is poorly-lit and it was pretty late That and she was pissed...
    I did not mean my comment to come of as a harsh criticism. I was not chastising you


    Quote Originally Posted by Awesomethepossum View Post
    I'm comfortable with your thoughts on it being female. I don't plan to breed, I just like knowing the sexes of my pets.

    I did request to join the facebook egg eater group a few days ago but havent heard back yet.
    The Admin of the group can be a little slow to reply.


    Quote Originally Posted by Awesomethepossum View Post
    In your experience, do you happen to have an idea of the longevity of these snakes? And would it be possible to see a picture of your setup?
    No clue what longevity is. My oldest was acquired as an adult and I have had her for eight years so far so I figure 10-12 is a safe bet



    Quote Originally Posted by Gocntry View Post
    So True, That's the "outside the box" thinking I need to learn to do more of!!

    Thanks for all the info!
    Happy to help


    Quote Originally Posted by Gocntry View Post
    So Egg Eaters can throw some attitude? Good to know
    It is all an act. But they sure can throw a great threat display when they are in the mood
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Awesomethepossum (11-18-2019),Gocntry (11-19-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1