Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 755

0 members and 755 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 1 of 2 12 LastLast
Results 1 to 10 of 15

Thread: New egg-eater

  1. #1
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    New egg-eater

    I just brought this lovely creature home on Sunday. A friend said it could be a D. gansi.

    Could anyone confirm this? Also, I was just looking for any tips or advice. And also, if there's a way to determine sex. I was told it was 4 years old, and it was referred to as a he, but I'm not sure if there's a degree of sexual dimorphism to help with distinguishing this. It had been getting fed one quail egg a week prior.

    The basking temps are at 95. Cold side is 70-75. I plan on getting better hides and more ground cover when I make a run to the store.

    1.0 Pumpkin Pied BP, 0.1 KSB, 0.1 Bearded dragon, 1.2 Leopard gecko, 0.1 Ornate Pacman Frog, 1.1 Barred tiger salamander

  2. The Following 4 Users Say Thank You to Awesomethepossum For This Useful Post:

    aurum (11-13-2019),Bogertophis (11-13-2019),Gocntry (11-14-2019),Reinz (11-14-2019)

  3. #2
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,791
    Thanks
    29,357
    Thanked 20,565 Times in 12,289 Posts
    Can't answer your questions, but congrats! what a cool addition! I know you'll be sharing here what you learn about "him"- we look forward to your updates.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  4. The Following User Says Thank You to Bogertophis For This Useful Post:

    Awesomethepossum (11-13-2019)

  5. #3
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New egg-eater

    Quote Originally Posted by Bogertophis View Post
    Can't answer your questions, but congrats! what a cool addition! I know you'll be sharing here what you learn about "him"- we look forward to your updates.
    The owner couldn't keep him/her anymore, and it had a calmer disposition than I expected so it was a last minute decision. This is why I have my own soldering iron and keep backup supplies

    I've become friends with the breeder that I got my KSB from, and she's also willing to be my quail egg provider I'm very grateful to her for that. Very excited to have a more diverse collection, and I'll be sure to share what I learn.

    1.0 Pumpkin Pied BP, 0.1 KSB, 0.1 Bearded dragon, 1.2 Leopard gecko, 0.1 Ornate Pacman Frog, 1.1 Barred tiger salamander
    Last edited by Awesomethepossum; 11-13-2019 at 04:22 PM.

  6. The Following User Says Thank You to Awesomethepossum For This Useful Post:

    Bogertophis (11-13-2019)

  7. #4
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,791
    Thanks
    29,357
    Thanked 20,565 Times in 12,289 Posts
    I know what you mean...I always have spare accommodations too. His (the snake's) lucky day that you were there & said yes.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  8. The Following User Says Thank You to Bogertophis For This Useful Post:

    Awesomethepossum (11-13-2019)

  9. #5
    BPnet Veteran Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    744
    Thanks
    482
    Thanked 991 Times in 475 Posts

    Re: New egg-eater

    Very Cool, will be watching this thread and learning from this.....

    Was going to get a pair of these (these can be cohabbed), but ended up with my problem baby BP's instead.

    So now I'll get thru winter and see if I can get a few next spring, Gives me time to find a quail egg supply in the mean time.

  10. The Following User Says Thank You to Gocntry For This Useful Post:

    Awesomethepossum (11-14-2019)

  11. #6
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New egg-eater

    Quote Originally Posted by Gocntry View Post
    Very Cool, will be watching this thread and learning from this.....

    Was going to get a pair of these (these can be cohabbed), but ended up with my problem baby BP's instead.

    So now I'll get thru winter and see if I can get a few next spring, Gives me time to find a quail egg supply in the mean time.
    There is so much information out there, and not much of it is consistent.

    Some say they need lots of space with plenty of height, and others say they're content in a tub. I initially had him in a 40 gallon for a few days, and he just sayed in the same spot in the corner without moving at all, so I worried he felt too exposed (but maybe I was wrong). The man I bought this one from said he had him in a 10 gallon at room temp, with an UTH set to 95. The rest of the tank was kept at room temp.

    I actually spoke with another individual who has a few young ones in tubs, and she agreed with the temps (70-75ish). But they're hardy snakes, so apparently the cool end could go down to 65 as long as UTH is available.. it just shouldn't drop too much more than that. I currently have him on a reptichip/aspen mix. Apparently they don't need more than an inch or so of substrate.

    I'll see how he does in the 37qt for the time being, and make sure he's eating. I know they like to climb, so if this isn't enough, I'll make the necessary adjustments and add more fake plants, branches, etc.

    I was originally told to just give him one egg a week, but this other individual recommended I offer him 2-3 quail eggs at a time. She's also kind enough to offer different sized eggs for me to try with him, since some can be finicky.

    I'll keep you guys posted

    1.0 Pumpkin Pied BP, 0.1 KSB, 0.1 Bearded dragon, 1.2 Leopard gecko, 0.1 Ornate Pacman Frog, 1.1 Barred tiger salamander

  12. The Following 2 Users Say Thank You to Awesomethepossum For This Useful Post:

    Bogertophis (11-14-2019),Gocntry (11-14-2019)

  13. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I need a better pic of the head but I believe this is D. medici and based on the size I am going to lean toward it being female. Sometimes you can tell based on post-cloacal scale count, you can also submit a shed to Ben Morrill/Reptile Genetic Services. DO NOT pop! DO NOT probe! These animals are entirely too fragile and you can break/kink their spine

    I have been keeping medici for years and what I have learned is this:

    These animals are best treated as semi/fully arboreal. I keep mine in a 37G tall style tank with multiple climbing branches and vegetation and use hanging finch nests as hides. 99.95% of the time the animals are in the aerial hides. I keep at ambient temp which ranges 23-27C in my snake room. Feeding should be done seasonally. I offer one egg every other week in March then two-three eggs every other week April-July, the rest of the year I withhold feeding. An animal the size of yours should be able to handle quail eggs without any difficulty. You should be able to find them at any international food mart, the typically available twenty-four pack should probably do you for the year.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following 6 Users Say Thank You to asplundii For This Useful Post:

    aurum (11-15-2019),Awesomethepossum (11-14-2019),Bogertophis (11-14-2019),Gocntry (11-14-2019),plateOfFlan (11-13-2021),Sonny1318 (11-18-2019)

  15. #8
    BPnet Veteran Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    744
    Thanks
    482
    Thanked 991 Times in 475 Posts

    Re: New egg-eater

    Quote Originally Posted by asplundii View Post
    I need a better pic of the head but I believe this is D. medici and based on the size I am going to lean toward it being female. Sometimes you can tell based on post-cloacal scale count, you can also submit a shed to Ben Morrill/Reptile Genetic Services. DO NOT pop! DO NOT probe! These animals are entirely too fragile and you can break/kink their spine

    I have been keeping medici for years and what I have learned is this:

    These animals are best treated as semi/fully arboreal. I keep mine in a 37G tall style tank with multiple climbing branches and vegetation and use hanging finch nests as hides. 99.95% of the time the animals are in the aerial hides. I keep at ambient temp which ranges 23-27C in my snake room. Feeding should be done seasonally. I offer one egg every other week in March then two-three eggs every other week April-July, the rest of the year I withhold feeding. An animal the size of yours should be able to handle quail eggs without any difficulty. You should be able to find them at any international food mart, the typically available twenty-four pack should probably do you for the year.

    Lots of Good Info, Thanks!

    Now a couple questions if you don't mind...

    The local breeder near me has "Dasypeltis gansi " would the same basic rules apply to these as well??

    These type of snakes can be Cohabited correct? (it's what I was told)

    When getting eggs from a local market, using refrigerated eggs and bringing them up to room temps before feeding works ok?

    Or do you need fresh eggs?

    And from August to February feeding is withheld? Wow, long time no eating.. of course with the stories of peoples BP's not eating I'm just not used to not feeding animals for that long.

  16. #9
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New egg-eater

    Quote Originally Posted by asplundii View Post
    I need a better pic of the head but I believe this is D. medici and based on the size I am going to lean toward it being female. Sometimes you can tell based on post-cloacal scale count, you can also submit a shed to Ben Morrill/Reptile Genetic Services. DO NOT pop! DO NOT probe! These animals are entirely too fragile and you can break/kink their spine

    I have been keeping medici for years and what I have learned is this:

    These animals are best treated as semi/fully arboreal. I keep mine in a 37G tall style tank with multiple climbing branches and vegetation and use hanging finch nests as hides. 99.95% of the time the animals are in the aerial hides. I keep at ambient temp which ranges 23-27C in my snake room. Feeding should be done seasonally. I offer one egg every other week in March then two-three eggs every other week April-July, the rest of the year I withhold feeding. An animal the size of yours should be able to handle quail eggs without any difficulty. You should be able to find them at any international food mart, the typically available twenty-four pack should probably do you for the year.
    I'm really glad you saw this post then- and I'm also glad I posted here. I've been getting a lot of different info, but obviously I want to do what's best for my snake. So whatever info or advice you have, I'll happily accept/take.

    Do these pictures work?

    Poor thing was really flustered that I dug it out to take these pictures. Has been digging around and tunneling, which I thought was strange..

    So you think it's female? She is pretty large, but I didn't have any information to refer to...I've been looking but knowing the actual species would probably help If they prefer arboreal setups, that's what I'll do.

    I left two different types of quail eggs in the tub. All fresh. So far, she's shown no interest, but if what you say is true than that would make sense. This is why I'm confused, because the seller said the guy who owned this snake was giving one egg a week

    1.0 Pumpkin Pied BP, 0.1 KSB, 0.1 Bearded dragon, 1.2 Leopard gecko, 0.1 Ornate Pacman Frog, 1.1 Barred tiger salamander
    Last edited by Awesomethepossum; 11-14-2019 at 09:57 PM.

  17. The Following 2 Users Say Thank You to Awesomethepossum For This Useful Post:

    Bogertophis (11-15-2019),Gocntry (11-16-2019)

  18. #10
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: New egg-eater

    She has a nice olive tone to her.

    1.0 Pumpkin Pied BP, 0.1 KSB, 0.1 Bearded dragon, 1.2 Leopard gecko, 0.1 Ornate Pacman Frog, 1.1 Barred tiger salamander

  19. The Following 3 Users Say Thank You to Awesomethepossum For This Useful Post:

    aurum (11-15-2019),Bogertophis (11-15-2019),Gocntry (11-16-2019)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1