» Site Navigation
0 members and 644 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
Could banana/coral glow be considered a form of T+ albinism?
It seems with other species people are quick to label reduced pigmentation morphs as a form of T+/caramel albinism. Many of these feature similar color schemes of adult bananas/ coral glows, featuring a yellow/ tan complexion with black freckling.
I understand the presence & mechanism tyrosinase, but what exactly makes a T+ albino a T+ albino?
Do bananas and coral glows technically meet the criteria of T+ albinism?
Thank You.
-
-
I had wondered this myself on a less sophisticated level. But they have dark eyes, so maybe that rules them out? I'm interesting in hearing back from the experts
2 BP's, one ratsnake, 2 dogs, 3 cats, 2 small caged birds, 7 chickens, and a toddler in a pear tree
-
The Following User Says Thank You to FollowTheSun For This Useful Post:
PartySnake13 (08-12-2019)
-
There are caramel albino ball pythons. A lot of people just call them "caramel", but I'm pretty sure they're T+ if anything is. Banana is a co-dom gene. It's not even recessive. As far as I know albinism is a recessive gene whether it's T+ or T-.
Last edited by the_rotten1; 08-12-2019 at 01:02 AM.
~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~
Check me out on iHerp, Instagram, & visit my store!

-
-
My female super Banana has eyes that are Ruby the way that a R-Locus dilute rat does. So there is some removal if pigment in the eyes from my own personal experience, if this helps either way.
They do appear black at a glance but you can see they are blood ruby colored in the light.
-
The Following 2 Users Say Thank You to pbenner For This Useful Post:
FollowTheSun (08-12-2019),PartySnake13 (08-12-2019)
-
Re: Could banana/coral glow be considered a form of T+ albinism?
There are no known T-negative albinos known in snakes. Even T-neg albino in the USA common rat snake is proven to not be T-neg.
-
The Following User Says Thank You to paulh For This Useful Post:
PartySnake13 (08-12-2019)
-
Registered User
Re: Could banana/coral glow be considered a form of T+ albinism?
 Originally Posted by the_rotten1
There are caramel albino ball pythons. A lot of people just call them "caramel", but I'm pretty sure they're T+ if anything is. Banana is a co-dom gene. It's not even recessive. As far as I know albinism is a recessive gene whether it's T+ or T-.
Method of inheritance is not a qualifying factor for Albinism.
-
-
Re: Could banana/coral glow be considered a form of T+ albinism?
The general definition among herpers for T-positive albinism is any mutant gene that is both recessive to the corresponding normal gene and seems to have some melanin but less than the normal amount. By this definition, coral glow/banana, lesser, pastel, and many other mutant genes are not T-positive albino genes.
I think that the recessive to the corresponding normal gene criterion is irrelevant. As far as I can tell, its only benefit is to keep the T-positive albino group of genes from being unmanagably large.
I generally ignore the T-positive/T-negative terminology. They are meaningless buzzwords. They make us think we know more about the biochemistry than we do, and they are totally artificial groupings. Besides, there are no proven T-negative albino snakes. The corn snake's "T-negative albino" mutant gene (AKA the amelanistic mutant gene) is now known to actually be OCA2-negative. As mating an amelanistic corn snake to a "T-negative albino" rat snake produces albino babies, the "T-negative albino" rat snake is also OCA2-negative instead of T-negative.
For example, in boas Kahl albino and Sharp albino are both classed as T-negative albino because neither produces melanin. Sharon Moore caramel is classed as T-positive because it produces some melanin. However, nobody has done the work to determine whether any of them directly affects production of the tyrosinase enzyme; possibly none of them do. The Sharon Moore caramel gene and the Sharp albino gene can form a gene pair, which means they are different versions of the same gene and part of a natural grouping. On the other hand, the Sharp albino gene and the Kahl albino gene cannot form a gene pair. They are not different versions of the same gene and not part of a natural grouping.
-
The Following 2 Users Say Thank You to paulh For This Useful Post:
Alicia (08-13-2019),PartySnake13 (08-12-2019)
-
To all intents and purposes, all the morphs we call T+ albino are actually some form or other of hypomelanism. This includes Banana/CG. The use of T+ in the hobby is just one more example of the bad information originally put out by early "big name" breeders who had/have a very limited understanding of genetics and proper terminology that has now become endemic and established as "fact"
As Paul noted, there are no confirmed T- albino snakes but that does not mean they are not out there. Given that only one species had been interrogated at the genetic level, and based on the inferred relationship between corns and rats that Paul also noted, we really only have a n=1 sample size so it is possible that one of the amelanistic-phenotype morphs out there in the entire hobby will turn out to be a true T-. I suspect we would be most likely find this to be the case in Burms or retics where there are 3-4 known amelanistic-phenotype
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Alicia (08-13-2019),paulh (08-13-2019),pbenner (08-13-2019)
-
Re: Could banana/coral glow be considered a form of T+ albinism?
 Originally Posted by asplundii
To all intents and purposes, all the morphs we call T+ albino are actually some form or other of hypomelanism. This includes Banana/CG. The use of T+ in the hobby is just one more example of the bad information originally put out by early "big name" breeders who had/have a very limited understanding of genetics and proper terminology that has now become endemic and established as "fact"
As Paul noted, there are no confirmed T- albino snakes but that does not mean they are not out there. Given that only one species had been interrogated at the genetic level, and based on the inferred relationship between corns and rats that Paul also noted, we really only have a n=1 sample size so it is possible that one of the amelanistic-phenotype morphs out there in the entire hobby will turn out to be a true T-. I suspect we would be most likely find this to be the case in Burms or retics where there are 3-4 known amelanistic-phenotype
One of my absolute favorite posters on this site. Thank you thank you!
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|