» Site Navigation
1 members and 699 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
BEL differences
I know this is asked a lot but most of the threads I’ve seen about it are outdated in terms of the genes that are available. I was under the impression that lesser/butter, russo, and mojave (sort of) were the only ways to get a pure while BEL, but I’ve been seeing some other morphs recently that look the same but have different names (bamboo etc). Are these actually new, or like lesser/butter in that they’re the same gene as another morph but a different line? Also, which combination makes the cleanest BEL? I’ve heard super lesser/butter but I have yet to see one in person. Most of the lesser mojaves I’ve seen have some sort of light shading from the mojave, but perhaps I just haven’t seen a good one. How do super russos compare to the others? That’s what I have and I think he’s pretty darn white, but again that could be due to my limited exposure to different BELs. Also, do other genes (spider, pastel, etc) coupled with BEL enhance or detract from their whiteness?
I know these are kind of subjective questions but I’m just curious as to what the 2019 consensus on this is
1.1 ball pythons, 2.0 BCIs, 1.0 western hognose, 1.0 honduran milk, 1.0 corn snake, 1.0 kenyan sand boa, 1.0 pueblan milk, 1.0 MBK, 1.0 checkered garter, 1.0 eastern garter, 1.0 coast garter, 1.0 plains garter
-
The Following User Says Thank You to KKM For This Useful Post:
-
First off, hi there, fellow Southern Californian!
Here's one of the more comprehensive lists I've seen of all the genes in the BEL complex: https://www.belgiandesignermorphs.co...n/bel-complex/
I also had the exact same question you did in one of my past threads, when I was getting ready to buy my BEL. It got a lot of helpful responses and example owner pics of different BEL gene combos: https://ball-pythons.net/forums/show...ue-eyed-lucies!
I think the general consensus was, like you said, that Super Lesser or Super Butter had the best chance of resulting in a BEL that stays clean white into adulthood. My own boy, Rae, is a Butter Mojave, and he's staying solid white so far, but he's only going on a year old, so time will tell, and I'll love him anyway, haha. Here's one of my more recent photos of him:

And if your userpic is any indication, your Super Russo is looking fantastic so far!
Ball Pythons:
2018 Cinnamon Enchi Ghost - Ignis ("Iggy")
2018 Butter Mojave BEL - Ravus ("Rae")
2022 Albino Super Lesser - Cyrus ("Cy")
Boa Imperator:
2018 Hypo Blood - Genesis ("Gen")
2019 IMG Motley - Requiem ("Q")
2019 Sharp Blizzard - Elysium ("Elys")
Iggy&Rae on Instagram: https://www.instagram.com/iggy_and_rae
-
The Following 5 Users Say Thank You to RedRabbit For This Useful Post:
Burticus (07-06-2019),KKM (07-05-2019),PartySnake13 (07-09-2019),the_rotten1 (07-04-2019),wonderfvl (07-04-2019)
-
The BluEL complex is quite large:
Butter/Lesser
Bamboo
Mojave
Russo
Mocha
Phantom/Mystic
Special (all three lines)
het Daddy
As far as "whitest" BluEL. You will get a handful of different answers and all of them are subjective. Over a decade in this hobby has shown me that most all BluEL combinations yellow out to some extent becoming less white and more cream and they also tend develop a visible dorsal stripe. The all-white Pied BluELs are stark white but you run into the microphthalmia problem with them.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Can a Lesser Mojave pass both genes? As in, if bred to normal, could you get a lesser, mojave, BEL, or normal as a result?
-
-
Re: BEL differences
 Originally Posted by drew5337
Can a Lesser Mojave pass both genes? As in, if bred to normal, could you get a lesser, mojave, BEL, or normal as a result?
No. You will only get Lessers and/or Mojaves from the clutch.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: BEL differences
 Originally Posted by asplundii
No. You will only get Lessers and/or Mojaves from the clutch.
This is due to the Gene's falling on the same allele. Basically what happens in a super, like the bel complex, is the two genes fit on the same spot and due to this only one or the other is passed on.
Sent from my SM-G965U using Tapatalk
-
-
Registered User
Re: BEL differences
 Originally Posted by Commander's Balls
This is due to the Gene's falling on the same allele. Basically what happens in a super, like the bel complex, is the two genes fit on the same spot and due to this only one or the other is passed on.
Sent from my SM-G965U using Tapatalk
Thats what I thought but I was overthinking it to myself.
-
-
Registered User
Re: BEL differences
 Originally Posted by drew5337
Thats what I thought but I was overthinking it to myself.
Easy to do. There is so much information it's hard to just sit down and simplify things
let's get the ball rollin'
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|