Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 679

1 members and 678 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,904
Threads: 249,099
Posts: 2,572,073
Top Poster: JLC (31,651)
Welcome to our newest member, GeneticArtist
Results 1 to 4 of 4
  1. #1
    Registered User
    Join Date
    07-05-2019
    Posts
    5
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Morph Market snake?

    Hey guys, I was searching for a super lesser on morph market and found this:
    It was listed under super lesser. I thought it might be a lesser mojave because of the yellow stripe. Can super lessers have striping or do they stay solid white through their lives?


  2. #2
    Registered User PartySnake13's Avatar
    Join Date
    07-03-2019
    Posts
    98
    Thanks
    145
    Thanked 29 Times in 21 Posts

    Re: Morph Market snake?

    It's probably not a super lesser. On outback reptiles website, they state that she was sold the them as a super lesser, indicating that they don't know what she is.

    When in doubt, ask the seller to subject their leucistics to black light testing. Super Lessers and 100% white pieds will have no visible pattern under blacklight.
    Last edited by PartySnake13; 07-13-2019 at 12:12 AM.

  3. #3
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Morph Market snake?

    Quote Originally Posted by PartySnake13 View Post
    It's probably not a super lesser. On outback reptiles website, they state that she was sold the them as a super lesser, indicating that they don't know what she is.

    When in doubt, ask the seller to subject their leucistics to black light testing. Super Lessers and 100% white pieds will have no visible pattern under blacklight.
    That's interesting, do you know if ivorys show pattern under blacklight? With the yellow dorsal and what looks to be black eyes, I would of guessed it was an ivory.

  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Morph Market snake?

    Quote Originally Posted by PartySnake13 View Post
    Super Lessers ... will have no visible pattern under blacklight.
    This is not correct. ALL BluELs can develop a dorsal stripe so it is very possible that animal is indeed a SuperLesser


    Quote Originally Posted by rufretic View Post
    do you know if ivorys show pattern under blacklight?
    Yes, Ivories also show a dorsal under blacklight


    Quote Originally Posted by rufretic View Post
    With the yellow dorsal and what looks to be black eyes, I would of guessed it was an ivory.
    The animal in question is certainly a BluEL. The only reason the eyes look darker is because they are in shadow with the head being pulled back under the body
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1