Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 491

1 members and 490 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
Welcome to our newest member, LeonoraOrdonez5
Results 1 to 10 of 16

Hybrid View

  1. #1
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts

    Re: Acid gene is looking wicked!

    Quote Originally Posted by Bogertophis View Post
    I like the male super pastel acid (asplundii's) & the female arsenic...you should def. get them both, Godzilla78. (I'm good at spending other ppl's money...)
    If I didn’t have so many upcoming bills, I would jump on that super pastel acid male!

  2. The Following 2 Users Say Thank You to Godzilla78 For This Useful Post:

    Bogertophis (06-15-2019),J-Royals (06-21-2019)

  3. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Acid gene is looking wicked!

    It is a fun gene, been enjoying playing with it in my collection

    Quote Originally Posted by Alexiel03 View Post
    been a while since I saw anything about them lol looks like there are a few combos around now.
    Josh (the originator of the morph) had some personal stuff hit him and also got totally dumped on by a bunch of people when he first brought his animals to market so he kind of went to ground, just was not interested in all the drama. But he and a few others of us have continued working the project and I expect you will see some really fun stuff from them later this season and moving forward


    Quote Originally Posted by Godzilla78 View Post
    If I didn’t have so many upcoming bills...
    I do payment plans... Just saying
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    Alexiel03 (06-17-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1