» Site Navigation
2 members and 654 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
|
-
Acid gene is looking wicked!
The really rare, expensive new genes on the market are mostly not at value to me. The acid gene however, is so vivid, it reminds me of a freaky GHI.
Might have to invest some serious dough to get in on this whacky artistic gene!
https://www.morphmarket.com/us/c/rep...hons/gene/acid
-
The Following 4 Users Say Thank You to Godzilla78 For This Useful Post:
Bogertophis (06-14-2019),dr del (06-15-2019),J-Royals (06-21-2019),Sonny1318 (06-14-2019)
-
Re: Acid gene is looking wicked!
Yeah its a pretty cool gene, they been around since 2014 but been a while since I saw anything about them lol looks like there are a few combos around now.
Sent from my LGL164VL using Tapatalk
-
The Following User Says Thank You to Alexiel03 For This Useful Post:
-
I like the male super pastel acid (asplundii's) & the female arsenic...you should def. get them both, Godzilla78. (I'm good at spending other ppl's money...)
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following 2 Users Say Thank You to Bogertophis For This Useful Post:
Godzilla78 (06-15-2019),J-Royals (06-21-2019)
-
Re: Acid gene is looking wicked!
 Originally Posted by Bogertophis
I like the male super pastel acid (asplundii's) & the female arsenic...you should def. get them both, Godzilla78.  (I'm good at spending other ppl's money...)
If I didn’t have so many upcoming bills, I would jump on that super pastel acid male!
-
The Following 2 Users Say Thank You to Godzilla78 For This Useful Post:
Bogertophis (06-15-2019),J-Royals (06-21-2019)
-
Re: Acid gene is looking wicked!
The acid phantom lemonblast is the best, but at 5 Gs, I think I will take - few years and make my own!
-
The Following User Says Thank You to Godzilla78 For This Useful Post:
-
I hear ya...it's a real chunk o' change for a creature that could get sick & die out of the blue. Tempting though...
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: Acid gene is looking wicked!
It is a fun gene, been enjoying playing with it in my collection
 Originally Posted by Alexiel03
been a while since I saw anything about them lol looks like there are a few combos around now.
Josh (the originator of the morph) had some personal stuff hit him and also got totally dumped on by a bunch of people when he first brought his animals to market so he kind of went to ground, just was not interested in all the drama. But he and a few others of us have continued working the project and I expect you will see some really fun stuff from them later this season and moving forward
 Originally Posted by Godzilla78
If I didn’t have so many upcoming bills...
I do payment plans... Just saying
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Josh Jensen

-
The Following 5 Users Say Thank You to J-Royals For This Useful Post:
asplundii (06-24-2019),Bogertophis (06-21-2019),Godzilla78 (06-21-2019),PghBall (07-08-2019),Sonny1318 (07-05-2019)
-
It's been a long time since I logged in here guys and gals. Here's some of the new Acid combos of 2019, some being posted in this thread before anywhere else.
Hope y'all enjoy.
Josh Jensen

-
The Following 2 Users Say Thank You to J-Royals For This Useful Post:
asplundii (06-24-2019),Godzilla78 (06-21-2019)
-
Re: Acid gene is looking wicked!
 Originally Posted by J-Royals
Wicked!
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|