Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,962

0 members and 1,962 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Results 1 to 10 of 24

Thread: Your #1 reptile

Threaded View

  1. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    No pics on my computer here but...

    From about the time I was 10 I had three "grail" species: GTP, BHP, and GBK. I was able to acquire two of those about a decade ago and picked up the third a few years back. Those three animals constitute my favourite
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bodie (06-06-2019),Bogertophis (06-06-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1