Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 488

0 members and 488 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,230
Posts: 2,572,849
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Page 5 of 5 FirstFirst 12345
Results 41 to 49 of 49

Thread: Making a BEL.

  1. #41
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Quote Originally Posted by paulh View Post
    Hooray, a Devil's Advocate! Maybe you can help me out with questions I've wondered about. I have many more questions than answers.
    This is what I like about you Paul, you give me an excuse to tick up my level of engagement in these conversatoins.

    And tangential, you are more than welcome to drop me a line off-boards if you have questions you want to thrash around. Always happy to talk herps


    Quote Originally Posted by paulh View Post
    Do the needs of the rodents equal the needs of breeder and baby snakes?
    In the broad sense the needs of the rodent are vastly different than the needs of the snake because the prior is a herbivore/insectivore and the latter is a strict carnivore. I know that you know this, I am simply stating it so we are on the same page as I move forward.

    So, the snake gets its nutrients from the rodents it eats and part of those nutrients come from what is in the guts of the rodent when it gets eaten. I have heard it argued that in the wild, the rodents are eating a diverse array of items so as a prey they are providing a broader spectrum of trace elements. However, what is more likely is that any one random bush rat will have found a berry bush an pigged out on those while a second random bush rat will have found a batch of seeds and stuffed itself on those so the gut loads will be different between the two and each will be high in some traces but low in others. And the randomness of which rodent gets eaten by the snake provides a balanced array of trace over time. In captivity however, the rodents are getting a balanced level of trace with each feeding which would mean that the snake then is also getting a balanced array of trace.

    In the end, both the wild and the captive are getting all the trace they need, one is jsut receiving it through constant stable delivery while the other is receiving it through random, punctuated delivery


    Quote Originally Posted by paulh View Post
    Wild fox snakes have raided my father's pigeon cages for eggs. Wild corn snakes and bullsnakes like eggs, too. Do eggs have some benefit that rodent prey lacks?
    I would guess that this behaviour is more in keeping with the opportunistic nature of snakes, they will eat what they come across and eggs are a bountiful package. If there were something specific about the eggs that was needed then you would see a behavioural change in the animals where the sought out eggs over any other type of prey/food item.

    We see this kind of opportunistic feeding across the animal kingdom. If you have ever watched videos of rehab primates in facilities getting bathed you will notice that they very frequently try to eat the soap. This is because they see the soap as a high source of lipids which are generally rare in nature.


    Quote Originally Posted by paulh View Post
    Do the commercial rodent breeders let the rodents sit around for a few hours without food between selection for killing and killing/freezing? This could reduce any gut-loading effect from the pellets.
    I cannot speak for what the rodent breeders do, I have never thought to ask. I am not sure a few hours would be enough to fully purge the guts of whatever load they are carrying though. It is certainly an item to consider.


    Quote Originally Posted by paulh View Post
    And food pellets slowly oxidize and lose vitamin content. Do the rodent breeders always use the pellets before expiration date? These are questions I cannot answer but which could affect the snakes' nutrition.
    Yes, the oxidation of the pellets does reduce the concentration/potency of the vitamins/trace over time but as long as they are used before their expiration then they should be okay. Also, I am not sure if animal feed is required to meet the standards of human food stuffs but the concentrations given in human foods are the minimum level they will be at upon reaching the 'Best By' date which means that prior to that date the concentrations are higher. If that is the case then the rodents, and by extension the snakes, would go through a waxing/waning cycle of trace not too unlike the wild ones. Except that the captives are waxing/waning all trace at the same time where as the wild would be waxing/waning different traces randomly.


    Quote Originally Posted by paulh View Post
    Why do some breeders produce fewer bugeyed snakes than others? Sheer luck alone?
    This is going to be tough for me to answer because I am not sure of the best way to translate my thoughts into something cohesive for the everyman...

    I am inclined to think that it is down to a pair of other factors. The first is a bit of luck though I see it as being the random stochasticity of genetic factors (call it whichever you will). The other factor is probably accidental selective breeding for secondary stabilizing mutations. The second-site mutations do not "cure" the problem but they reduce the tendency towards it being manifest.

    Does that make sense?


    Quote Originally Posted by paulh View Post
    Could a snake with a specific morph need a higher level of a specific nutrient to develop than a normal snake, and some breeders, by luck, do a better job of catering to that need?
    That could certainly be a possibility with some mutations. Since we do not know the specific nature of any of our mutations I am not sure I can direct a literature search tight enough to cite anything specific though.


    Quote Originally Posted by paulh View Post
    Bugeyes are fairly common in homozygous lesser ball pythons and homozygous leucistic rat snakes. These are (probably) different genes in different snake families, but both produce blue eyed leucistics, some of which are bugeyed. Are these genes in the same biosynthetic pathway?
    From what I have seen, most species with a BluEL mutant show an inclination to bug-eye so I would be inclined to think that these mutations are very likely in the same pathway and there is a good chance that they are actually the same gene.


    Quote Originally Posted by paulh View Post
    I think we are seeing a higher instance of defects in captive breeding compared to wild breeding. A higher percentage of slugs, vertebral kinks and small/missing eyes as well as bug eyes. This is across the board as well as in specific morphs.
    I think this might be a spurious correlation. In captivity we are selecting for defects already (because that is what morphs are when you get down to it) so naturally we would see in uptick in presentation of deformities that present as secondary phenotypes to the mutations, especially when we are cramming as many mutations into our animals as possible (I am frequently amazed by the number of mutations we can get in one animal and still have it be viable). We also need to consider that in the wild most of the defective animals are going to have a very high attrition rate and get picked off before we can ever observe them. So are defects really occurring at a higher instance? Or are we simply better able to observe them because the selective pressures that typically purge them in the wild have been relieved in captivity?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    paulh (04-05-2019),ShawarmaPoutine (04-06-2019)

  3. #42
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Making a BEL.

    Quote Originally Posted by Eye4Pythons View Post
    I think that has more to do with the number of BPs being bred in captivity compared to in the wild, and the fact that we're bringing a much higher percentage to term. Plus, there _is_ the whole 'you don't have to do anything more than buy two snakes in order to attempt to breed' thing. I'd dare say there's a noteworthy percentage of new breeders who are less than fully prepared when they start. That doesn't exactly help the overall success rate.
    I've never bred ball pythons. I've mostly worked with North American colubrids (garter snakes, bullsnakes, corn snakes). The whole 'you don't have to do anything more than buy two snakes in order to attempt to breed' thing describes me to a T when I started.

    Quote Originally Posted by ShawarmaPoutine View Post
    What’s are the things many noobs ignore when thinking “you don’t have to do anything more than buying two snakes in order to attempt to breed.”
    What weather/climate conditions stimulate the snakes to breed in the wild. When the males develop sperm. Do the snakes need a day/night temperature cycle for sperm survival? Is brumation necessary, and if so, how low? Those are some of the things I had to figure out when breeding my snakes.

  4. The Following User Says Thank You to paulh For This Useful Post:

    ShawarmaPoutine (04-06-2019)

  5. #43
    Registered User
    Join Date
    04-08-2019
    Posts
    27
    Thanks
    2
    Thanked 5 Times in 3 Posts
    As far as breeding for both healthwhise and most white, it looks like the consensus is to go with Mojave x Lesser..
    I am wondering though: would adding in pastel or super pastel increase the chances the snake stays pure white and never develops yellow or grey on it? Or would this have no effect?

  6. #44
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Making a BEL.

    Quote Originally Posted by Aziara View Post
    As far as breeding for both healthwhise and most white, it looks like the consensus is to go with Mojave x Lesser..
    I am wondering though: would adding in pastel or super pastel increase the chances the snake stays pure white and never develops yellow or grey on it? Or would this have no effect?
    Not sure what Pastel would do. I am inclined to think it might put a light yellowish wash to the animal and increase the instance/prominence of the dorsal stripe.

    If I were aiming to push toward highest likelihood of pure white I would be more inclined to use Fire (or related allele) and possibly Yellowbelly. Champagne might also work but I can also see how it might backfire so...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (04-15-2019)

  8. #45
    Registered User
    Join Date
    04-08-2019
    Posts
    27
    Thanks
    2
    Thanked 5 Times in 3 Posts

    Re: Making a BEL.

    Quote Originally Posted by asplundii View Post
    Not sure what Pastel would do. I am inclined to think it might put a light yellowish wash to the animal and increase the instance/prominence of the dorsal stripe.

    If I were aiming to push toward highest likelihood of pure white I would be more inclined to use Fire (or related allele) and possibly Yellowbelly. Champagne might also work but I can also see how it might backfire so...
    Whoa... but the super fire is black eyed lucy, right?
    What happens if you have super fire AND mojave/lesser?? Are the eyes black or blue?

  9. #46
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: Making a BEL.

    Quote Originally Posted by Aziara View Post
    Whoa... but the super fire is black eyed lucy, right?
    What happens if you have super fire AND mojave/lesser?? Are the eyes black or blue?
    It would look a lot like this.

    http://www.worldofballpythons.com/mo...-super-butter/

    - Charles Eye

  10. #47
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Making a BEL.

    Quote Originally Posted by Aziara View Post
    Whoa... but the super fire is black eyed lucy, right?
    Yes, SuperFire is a BlkEL. But the Fire mutation (and its alleles) are a defect in pigment distribution/deposition so when combined with the BluEL group (which are also a defect in pigment distribution/deposition) you are more likely to get a synergistic effect


    Quote Originally Posted by Aziara View Post
    What happens if you have super fire AND mojave/lesser?? Are the eyes black or blue?
    As Eye linked: white snake, blue eyes
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #48
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Making a BEL.

    Quote Originally Posted by asplundii View Post
    As Eye linked: white snake, blue eyes
    But with a contrasting red pupil. I remember seeing one in person a few years back at a local show. It's really neat.

  12. The Following User Says Thank You to OhhWatALoser For This Useful Post:

    Eye4Pythons (02-07-2020)

  13. #49
    Registered User
    Join Date
    03-21-2019
    Posts
    6
    Thanks
    7
    Thanked 3 Times in 2 Posts

    Re: Making a BEL.

    Quote Originally Posted by Danger noodles View Post
    To to be completely honest, this isn’t a play around thing breeding animals.
    So you're opposed to hobby breeders?

Page 5 of 5 FirstFirst 12345

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1