Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 729

0 members and 729 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 31

Threaded View

  1. #24
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by Eramyl View Post
    As for parthenogenesis, a female will produce exact copies of herself, with the lack of male presence. If at any time a male was introduced to that female it is extremely unlikely the clutch would be a partho clutch unless all the babies were exact copies of the mother, which could still happen when bred normally.

    It would not be possible for a pastel female to make super pastels by partho. The male was probably just low quality pastel or the female could have been a low quality super..
    That is not correct Eramyl. In parthenogenesis the female produces half-clones of herself so a female Pastel that threw a partho clutch would produce only SuperPastels and normals.

    And it is also very possible for females to throw partho clutches when exposed to males. I have an animal that has done it at least twice and Warren Booth has documented a slew of cases
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    pbenner (03-20-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1