Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 792

1 members and 791 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 3 of 4 FirstFirst 1234 LastLast
Results 21 to 30 of 31
  1. #21
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by pbenner View Post
    I listened to this on the start of my ride down to Texas. Exactly what I was looking for. Thank you so much.

    Paul

    Glad to be of help
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #22
    BPnet Veteran Eramyl's Avatar
    Join Date
    12-22-2013
    Location
    Wichita Falls, Texas
    Posts
    202
    Thanks
    26
    Thanked 93 Times in 67 Posts
    As for parthenogenesis, a female will produce exact copies of herself, with the lack of male presence. If at any time a male was introduced to that female it is extremely unlikely the clutch would be a partho clutch unless all the babies were exact copies of the mother, which could still happen when bred normally.

    It would not be possible for a pastel female to make super pastels by partho. The male was probably just low quality pastel or the female could have been a low quality super.

    - - - Updated - - -

    Also, what part of Texas are you moving to? I'm up in Wichita Falls.

  3. #23
    BPnet Veteran
    Join Date
    10-18-2018
    Location
    Brady, TX
    Posts
    224
    Thanks
    37
    Thanked 264 Times in 129 Posts
    Images: 21

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by Eramyl View Post
    As for parthenogenesis, a female will produce exact copies of herself, with the lack of male presence. If at any time a male was introduced to that female it is extremely unlikely the clutch would be a partho clutch unless all the babies were exact copies of the mother, which could still happen when bred normally.

    It would not be possible for a pastel female to make super pastels by partho. The male was probably just low quality pastel or the female could have been a low quality super.

    - - - Updated - - -

    Also, what part of Texas are you moving to? I'm up in Wichita Falls.
    Well, based on information I have since gathered I am convinced that the guy in question didn't quite understand what he was trying to teach or discuss. Even if he did he couldn't put it into a cohesive structure.

    I'm not going to get into a debate about something I barely have a toothpick to stand on.

    In regards to where; I drove through Wichita Falls early this morning. I live in Brady now. I saw there was a show up there a while back, but opted not to go.

    Best,

    Paul

  4. #24
    BPnet Veteran Shayne's Avatar
    Join Date
    11-06-2018
    Location
    Louisiana
    Posts
    497
    Thanks
    750
    Thanked 437 Times in 253 Posts

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by pbenner View Post
    My apologies. I honestly had no clue. No offense intended!
    Don't sweat it, Paul. You're not the 1st as I've done the exact same thing. I think if BogerChic would (cough) post a pic (cough) then maybe we wouldn't be so quick to say otherwise.

  5. The Following 2 Users Say Thank You to Shayne For This Useful Post:

    JRLongton (03-20-2019),Toad37 (03-20-2019)

  6. #25
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: A Breeder jumped down my throat at Tinley...

    I've been on both sides of genetics lectures, so I sympathize with both sides. Nevertheless, there is a time and place for them, and a reptile sale probably isn't either.

    To answer the codominant question, here is a quote:
    "In his law of dominance, Mendel did not accommodate different degrees of dominance. As such examples were discovered (Bateson 1913), various new terms were introduced. Within and between textbooks of genetics definitions are inconsistent. Various names have been used: partial dominance, incomplete dominance, codominance, lack or absence of dominance, intermediate dominance, imperfect dominance, egalitarian dominance, and transdominance. The definitions vary from text to text and depend on interpretation of allelic function, although an allele’s function is seldom known and often must be assumed. In all these usages there is one consistent aspect; each genotype has a distinguishable phenotype, and the genotype may be inferred from the phenotype. Perhaps none of the terms that have been used are all-inclusive, but some such term is desirable for teaching purposes. We have chosen the term codominance as simplest, shortest, and adequately inclusive. One can still use specialized sub-definitions for well-analyzed cases. In our more that 20 years of teaching this method has worked well."

    From Miller, W. J. and Hollander, W. F., 1995, Three neglected advances in classical genetics, BioScience 45: 98-104. Available on Miller's web site, www.ringneckdove.com.

    Any breeder would probably find the whole paper worth reading.

  7. The Following 2 Users Say Thank You to paulh For This Useful Post:

    Dianne (03-19-2019),JRLongton (03-20-2019)

  8. #26
    BPnet Veteran Eramyl's Avatar
    Join Date
    12-22-2013
    Location
    Wichita Falls, Texas
    Posts
    202
    Thanks
    26
    Thanked 93 Times in 67 Posts
    That was the first show we have had up here. The vendors had some cool stuff but not a lot pf people buying just yet. Saw a lot of curious kids and scared parents handling animals though. Hopefully it'll get things going up here. I'm glad your trip wasn't eventful.

  9. #27
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by Eramyl View Post
    As for parthenogenesis, a female will produce exact copies of herself, with the lack of male presence. If at any time a male was introduced to that female it is extremely unlikely the clutch would be a partho clutch unless all the babies were exact copies of the mother, which could still happen when bred normally.

    It would not be possible for a pastel female to make super pastels by partho. The male was probably just low quality pastel or the female could have been a low quality super..
    That is not correct Eramyl. In parthenogenesis the female produces half-clones of herself so a female Pastel that threw a partho clutch would produce only SuperPastels and normals.

    And it is also very possible for females to throw partho clutches when exposed to males. I have an animal that has done it at least twice and Warren Booth has documented a slew of cases
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    pbenner (03-20-2019)

  11. #28
    BPnet Veteran
    Join Date
    10-18-2018
    Location
    Brady, TX
    Posts
    224
    Thanks
    37
    Thanked 264 Times in 129 Posts
    Images: 21

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by asplundii View Post
    That is not correct Eramyl. In parthenogenesis the female produces half-clones of herself so a female Pastel that threw a partho clutch would produce only SuperPastels and normals.

    And it is also very possible for females to throw partho clutches when exposed to males. I have an animal that has done it at least twice and Warren Booth has documented a slew of cases
    I thought that this was the case as well, but like I said, I am not far enough along in my understanding to try to stand up in this argument.

  12. #29
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by pbenner View Post
    I listened to this on the start of my ride down to Texas. Exactly what I was looking for. Thank you so much.

    Paul
    What part of Texas? I am south of Houston. If close enough we should have a herping day where we share the love of our animals.

  13. #30
    BPnet Veteran
    Join Date
    10-18-2018
    Location
    Brady, TX
    Posts
    224
    Thanks
    37
    Thanked 264 Times in 129 Posts
    Images: 21

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by Skyrivers View Post
    What part of Texas? I am south of Houston. If close enough we should have a herping day where we share the love of our animals.
    I'm in Brady, Tx - I'll be headed to San Antonio for the show at the end of the month if you want to meet up on Saturday. I'll be doing quite a few others just to get out of a town of 5500 people on the regular. lol

    Paul

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1